Cell culture and mice

Mouse peritoneal macrophages were isolated from the peritoneal cavities of mice injected with thioglycolate medium for 3 days and cultured in RPMI-1640 culture medium supplemented with 10% fetal bovine serum (FBS, Gibco). Mouse BMDMs were cultured in DMEM medium with 10% fetal bovine serum (Gibco) and were induced from bone marrow cells by adding 20 ng/mL of recombinant mouse M-CSF (R&D Systems) for 5 days. Mouse bone marrow-derived dendritic cells (DCs) were cultured in RPMI-1640 medium with 10% fetal bovine serum (Gibco) and were induced from bone marrow cells by adding 20 ng/mL recombinant mouse GM-CSF (R&D Systems) and 20 ng/mL recombinant mouse IL-4 (R&D Systems) for 7 days. HEK-293T, THP-1, and RAW 264.7 cell lines were from the American Type Culture Collection (ATCC) and cultured in DMEM medium supplemented with 10% FBS (Thermo Fisher Scientific). All cell lines were tested negative for mycoplasma.

The GLO2 ARE mutation RAW 264.7 cell line was generated using the CRISPR-Cas9 system with the method of homology-dependent repair (HDR). Briefly, the sequence of sgRNA was designed by the online tool CRISPick (https://portals.broadinstitute.org/gppx/crispick/public/), and the design of single-stranded oligodeoxyribonucleotides (ssODNs) complied with the guidelines for donor design from the Geraldine Seydoux lab.53 Using Lipofectamine™ 3000 reagent (Invitrogen), RAW 264.7 cell line was co-transfected with ssODN: 5′- CCCTTAGCTTGTGTTATCAAATGTTCTAATGCATATATATAAGAGAAAAAAGGTTTAAAGTATATATTCCCATAACCTCTGCTTATCGACTCTTTATTACCTCTGGCTCTCCCGGTCTATAAC-3′, and pSpCas9(BB)-2A-GFP plasmid (addgene ID: #48138) that was inserted with sgRNA sequence: 5′-ATTCCCATAACCTCTGCTTA-3′. Then monoclonal cells were sorted by Fluorescence Activated Cell Sorting (FACS) system (SH800S, SONY). The sequences of mutation on Hagh ARE-sites were sequenced by the Sanger method. The sequencing primers are as follows: F: 5′-ACAGCATGCTGGCGAGACAG-3′; R: 5′-CAGGCATCTCCTTCCCAAAG-3′.

Human PBMCs were isolated from peripheral blood through Ficoll-Hypaque (Mediatech Cellgro) density gradient centrifugation. Blood samples from healthy donors came from the blood centers of Changhai Hospital (Shanghai, China), Changzheng Hospital (Shanghai, China), and Xinhua Hospital of Zhejiang Province (Hangzhou, China). The study was performed in accordance with the declaration of Helsinki and approved by the Ethics Committee of Second Military Medical University, Shanghai, China (no. 20210301-7). PBMCs were cultured in RPMI-1640 medium with 10% FBS (Gibco).

For stimulation of macrophages, DCs, and PBMCs, indicated concentration of LPS (L3755, Sigma-Aldrich), Poly (I:C) (#tlrl-picw, InvivoGen), R848(vac-r848, InvivoGen), C12-iE-DAP (tlrl-c12dap, InvivoGen), HT-DNA (D6898, Merck), β-1,3-glucan (tlrl-curd, InvivoGen), heat-killed preparation of Candida albicans (HKCA) (tlrl-hkca, InvivoGen), ATP (HY-B2176, MedChemExpress), nigericin (GC39719, GLPbio), ionomycin (HY-13434, MedChemExpress), and MitoPQ (HY-130278, MedChemExpress) was added to the medium for the indicated time points.

For inhibition experiments, NF-κB inhibitor PDTC (20 μM), TBK1 inhibitor MRT67307 (0.2 μM), JNK inhibitor JNK-IN-8 (1 μM), p38 inhibitor VX-702 (5 μM), AKT inhibitor Akti-1/2 (10 μM), and PKC inhibitor AEB071 (5 μM) were added to the cell culture medium for 1 h and then stimulated as indicated.

For stimulation of macrophages with cytokines, recombined mouse IFNα (10149-IF, R&D systems), IL-6 (406-ML, R&D systems), IL-1β (HY-P7073, MedChemExpress), IFNγ (HY-P700184AF, MedChemExpress), and TNFα (410-MT, R&D systems) were added to the medium for indicated time points. For stimulation of T cells, 100 ng/mL PMA (P8139, Sigma-Aldrich) and 1 μg/mL of ionomycin (HY-13434, MedChemExpress) were added to the medium for the indicated time points. For inhibition of GLO2 or GLO1, the indicated concentration of DiGMOC-G (GA23220, GLPbio), or 5 μM of BrBzGCP2 (HY-136684, MedChemExpress) was added to the medium for the indicated time points. For analysis of mRNA decay, 5 μM of Actinomycin D (HY-17559, MedChemExpress) was added to the medium for the indicated time.

WT C57BL/6 and Balb/c mice were purchased from Sipper BK Experimental Animals (China). Ifnar−/−, Ifnb−/−, and Il1r−/− C57BL/6 mice were purchased from the Jackson Laboratory. HAGH fl/flLyz2creERT2, Ttp−/−, RelAfl/flLyz2creERT2, GLO2 OE, Rosa26icre, and K18-hACE2 C57BL/6 mice were purchased or constructed from GemPharmatech Co., Ltd. For tamoxifen-induced knockout of the GLO2 gene, tamoxifen (HY-13757A, MedChemExpress) was i.p. injected into HAGHfl/flLyz2creERT2 mice following the standard protocol from the Jackson Laboratory (https://www.jax.org/research-and-faculty/resources/cre-repository/tamoxifen). All mice were housed under specific pathogen-free (SPF) conditions. K18-hACE2 mice were kept in Biosafety Level 3 (BSL-3) housing for the experiments using SARS-COV-2 infection, which was kindly provided by Prof. Zhao Ping. Studies involving experimental animals were approved by the Ethics Committee of the Second Military Medical University, Shanghai, China (no. 20220301-7).

Pathogens

VSV (Indiana Strain) was amplified by infection of a monolayer of HEK-293T cells. HSV-1 was amplified by infection of a monolayer of Vero cells. Sendai virus (SeV) was propagated in SPF chicken eggs. E. Coli (O111:B4) was amplified by culturing in an LB medium. Listeria monocytogenes was amplified by culturing in the BHI medium. The SARS-CoV-2 Omicron (B.1.1.529) strain was isolated from a laboratory-confirmed COVID-19 patient. All experiments involving live SARS-CoV-2 were performed in the BSL-3 laboratories at the Second Military Medical University.

Plasmid constructions and overexpression

Coding sequence (CDS) of mouse IRF3-5D mutant (IRF3(5D)) (Gene ID: 54131), MAPK3(Gene ID: 26417), MAPK p38(Gene ID: 26416), JNK1(Gene ID: 26419), AKT1(Gene ID: 11651), IFIT3 (Gene ID: 15959), MAPK1 (Gene ID: 26413), RelA (Gene ID: 19697), STAT1 (Gene ID: 20846) and IκBα (Gene ID: 18035) were each amplified using high fidelity polymerase KOD Neo (Toyobo) from mouse macrophage cDNAs. And CDS of these genes was cloned into pCDNA3.1/Flag(-) B vector (Life technology). Next, RelA mutations were cloned using site-directed mutagenesis. Vectors carrying relevant coding genes were transfected into HEK-293T cells and used in indicated assays.

Q-PCR

Total RNA of cells or tissues was isolated with TRIzol (Life technology), and 800 ng of RNA was reverse transcribed with Oligo(dT) or random primers into cDNA with High Efficient Reverse Transcription Kit (Toyobo). The indicated gene was amplified using SYBR Green (Toyobo) by the ABI QuantStudioTM 12 K Flex system. Primer sequences used in Q-PCR were the same as in our previous work.54 For analysis of GLO2 isoforms, primers of human cytosolic isoform: F: 5′-GCGCGAGCGCGTTGATTGG-3′; R: 5′-GGCTGGACTGCCGAGCTGC-3′. And primers of human mitochondria isoform: F: 5′-GCAGTCCCCCCACCCACGC-3′; R: 5′-CTCCCTGCCGGGGGCCT-3′. The relative level of RNA expression was normalized to HPRT or ACTB based on the calculation of 2-ΔΔCt.

RNA-seq assay

RNA-seq assays were performed by TIANGEN Co., Ltd. according to TIANGEN’s standard protocol. Briefly, after total RNA extraction and DNase I treatment, the TIANSeq mRNA capture kit (TIANGEN Biotech) was used to enrich eukaryotic total RNAs with Poly-A structure. Then the TIANSeq rapid RNA library construction kit (Illumina platform) (TIANGEN Biotech) was used to construct the library. After RNA fragmentation, cDNA synthesis, end repair, single nucleotide A (adenine) addition, adapter ligation, and PCR library enrichment, construction of the transcriptome sequencing library was completed. During the QC steps, Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System were used in the quantification and qualification of the sample library. Finally, the library was sequenced using Illumina HiSeq2000 or Illumina novaseq 6000, and around 150 bp paired-end sequencing reads were obtained. Differential expression analysis per group was performed using FPKM values. Heatmap and GO/ KEGG/ GSEA pathway enrichment analyses were performed using R-studio, GSEA, and GraphPad Prism 10.0.

Immunoblotting assay

Cells were lysed with cell lysis buffer (Cat#9803, Cell Signaling Technology) and supplemented with a protease inhibitor cocktail (Calbiochem, La Jolla, CA) for immunoblotting analysis. Protein concentrations of the extracts were measured using the bicinchoninic acid assay (Cat#23225, Thermo Scientific). Different protein samples were loaded onto a gel and subjected to SDS-PAGE, transferred onto nitrocellulose membranes, and then blotted. Anti-GLO2 (AF5944) antibody was from Novus Biologicals, anti-GLO1 (MA1-13029) antibody was from Invitrogen; anti-D- lactyllysine (PTM-1429), anti-l-lactyllysine (PTM-1401RM), anti-lactyllysine (PTM-1401), anti-Carboxyethyllysine (PTM-1701RM), anti-2-hydroxyisobutyryllysine (PTM-801), anti-crotonyllysine (PTM-501), and anti-malonyllysine (PTM-901) antibodies were from PTMbio; anti-phospho-STAT1(Y701) (9167), anti-STAT1 (9172), anti-phospho-TBK1(S172) (5483), anti-TBK1 (3504), anti-phospho-p65(S536) (3033), anti-p65 (8242), anti-IκBα (4814), anti-phosphor-IRF3(S396) (4947), anti-IRF3 (4302), anti-phospho-P38(T180/Y182) (9211), anti-P38 (9212), anti-AlM2 (63660), anti-NLRP3 (15101), anti-IL-1β (12242), and anti-Flag(HRP Conjugate) (86861) antibodies were from Cell Signaling Technology; anti-TTP (12737-1-AP), anti-COXIV (11242-1-AP), anti-Actin (81115-1-RR), and anti-GAPDH (60004-1-Ig) antibodies were from Proteintech.

scRNA-seq analysis

Four samples from the GSE226488 (GSM7077865 and GSM7077866, labeled as “rest” and “stim”) and GSE243629 (GSM7792046 and GSM7792040, labeled as “HC” and “IA”) datasets in GEO database were analyzed. Expression matrices for all samples were processed in R (version 4.3.1) using the Read10X function from Seurat (version 4.3.0.1). Briefly, for quality control, doublets were removed using “doublets_false” files (for “rest” and “stim”) published on GitHub and the DoubletFinder(version 2.0.3) package (for “HC” and “IA”). Cells with fewer than 3 detected genes, and those with either fewer than 200 or more than 7000 (for “rest”), 6200 (for “stim”), and 4000 (for “HC” and “IA”) detected features were excluded. Additionally, cells exceeding a mitochondrial gene threshold of 14% (for “rest” and “stim”), 15% (for “HC”), and 13% (for “IA”) were filtered out. Each sample was normalized using the SCTransform function. Then samples were integrated via canonical correlation analysis (CCA). Cell clusters were identified based on the UMAP reduced-dimension representation using the FindNeighbors and FindClusters functions, with resolution parameters set at 0.9 for “LPS”, and 0.7 for “IAV”. Finally, the expression of GLO2 was visualized using FeaturePlot and DotPlot.

Enzyme activity assay of GLO2 and GLO1

The enzyme activity of GLO2 was measured by the Glyoxalase II Activity Assay Kit (Grace Biotechnology, G0145W). Each cell sample (2 × 106) was lysed using extracting solution from the kit, then samples were centrifuged for 10 min at 4 °C,13,000 rpm. Cleared supernatants were transferred to new microcentrifuge tubes and kept at room temperature. According to the manufacturer’s instructions, the absorbance of samples and blanks were read at the reaction time of 2 min and 5 min at a wavelength of 412 nm, and GLO2 activity was calculated according to standard curves.

The enzyme activity of GLO1 was measured using the Glyoxalase I Activity Assay Kit (Sigma-Aldrich, MAK114). Briefly, each cell sample (2 × 106) was lysed by Assay Buffers, and then samples were centrifuged for 10 min at 4 °C,13,000 rpm. Cleared supernatants were transferred to new microcentrifuge tubes. Next, 40 μL of each sample was transferred into two separate microcentrifuge tubes, with one tube as the sample reaction and one tube as the sample blank. The Master Reaction Mix was prepared and the assay was operated according to the instructions of standard protocol. The absorbance of samples and blanks was read at 240 nm (A240), and the GLO1 activity of each sample was calculated according to the standard curves.

RNA fluorescence in situ hybridization (FISH) and immunofluorescence (IF)

Probes targeting human GLO2 mRNA were designed using Stellaris® Probe Designer version 4.2 (https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer). Probes modified with Cy3 at the 3′ terminus were synthesized by Sangon. Co. Ltd. Then, RNA FISH simultaneous IF was performed according to the protocol for simultaneous IF + Stellaris RNA FISH in adherent cells (LGC, Biosearch Technologies). Briefly, human 293 T cells cultured on poly-l-lysine coated cover slips were fixed with 4% formaldehyde for 10 min, followed by permeabilization with buffers included in the kit. Then cells were resuspended in 1 mL of 70% ethanol for 1 h at 4 °C. After washing, 100 μL of the Hybridization Buffer (SMF-HB1-10, LGC, Biosearch Technologies) containing probe plus (125 nM) and 5 μL of anti-TTP antibody (12737-1-AP, Proteintech) was added onto the parafilm, then incubated in the dark at 37 °C for 12 h. After washing, 1:500 of Alexa Fluor 647 anti-rabbit secondary antibody (Invitrogen, A-21245) was added and incubated in the dark at 37 °C for 30 min followed by staining of nuclei with DAPI (Invitrogen). After washing, the cover slips were mounted with ProLong™ Glass Antifade Mountant (Invitrogen). Images were obtained using a Leica TCS SP8 confocal microscope equipped with a ×63/1.40NA objective. Images were analyzed using the LAS X software version 2.1.2.15022 and Coloc2 from ImageJ (Fiji) 2.14.0 software.

ChIRP by MS and immunoblotting assay

Probes targeting human and mouse GLO2 mRNA were designed using ChIRP® Probe Designer version 4.2 (https://www.biosearchtech.com/support/tools/design-software/chirp-probe-designer). Probes modified with biotin-TEG at the 3′ terminus were synthesized by Sangon. co. Ltd. Human THP-1-induced macrophage or mouse PM Cells were stimulated by VSV for 9 h (MOI = 1). 4 × 108 cells were fixed with 4% formaldehyde for 30 min, then cells were lysed and sonicated with 6 mL lysis buffer (50 mM Tris-HCl, pH 7.0, 10 mM EDTA, 2% SDS, 1 mM PMSF, RRI (Takara) 1:50) followed by centrifugation to get clear cell lysates. Cell lysates were mixed with 4 mL of lysis buffer and 10 mL of hybridization buffer (50 mM Tris-HCl, pH 7.0, 750 mM NaCl, 1% SDS, 1 mM EDTA, 15% formamide, 1 mM PMSF, RRI 1:40). After pretreatment with RNase or not, cell lysates were incubated with probes (33 nM) respectively at 37 °C for 12 h followed by adding Dynabeads MyOne Streptavidin C1 (Thermo Fisher Scientific) and incubating for 1 h at 37 °C. After five washes with buffer (2× SSC, 0.5% SDS, PMSF 1:100), beads were divided into two parts. One part (1/10 beads) was digested with proteinase K (100 μg/mL, Thermo Fisher Scientific) and subjected to RNA purification using a TRIzol reagent. The other part (9/10 beads) was treated with RNase A (100 μg/mL) at 37 °C for 30 min and then boiled with protein loading buffer for LC–MS/MS and immunoblotting analysis.

For LC–MS/MS analysis, the mass spectrometer detection and data processing were performed by PTMbio according to PTMbio’s standard protocol. Briefly, The proteins in the gel were digested into peptides by adding 10 ng/μL trypsin at 37 °C overnight. The peptides were separated using the EASY-nLC 1200 UPLC system (Thermo Fisher Scientific). After separation by the UPLC system, the separated peptides were analyzed in Orbitrap Exploris 480 with a nano-electrospray ion source. The resulting MS/MS data were processed using the PD search engine (v.2.4).

RIP (Native-RIP and FA-CLIP)

Native-RIP and FA-CLIP were performed as described previously.54,55 Briefly, for native-RIP, cell lysate was harvested with cell lysis buffer (Cell Signaling Technology) directly from 5 × 106 BMDM cells. The TTP–RNA complex was then precipitated with TTP antibody and anti-rabbit magnetic beads (Merck). RNA from TTP–RNA complexes was extracted with the TRIzol reagent. For FA-CLIP, 1 × 107 BMDM cells were fixed with 1% formaldehyde and then lysed with cell lysis buffer (Cell Signaling Technology) and 2% SDS, followed by sonication with a high level until the cell lysate was clarified. The TTP–RNA complexes were then precipitated with TTP antibody and anti-rabbit magnetic beads (Merck). Bead-bound TTP–RNA complexes were eluted with elution buffer (1% SDS, 0.1 M NaHCO3) and de-crosslinked by adding NaCl to 200 mM. Finally, the eluate was digested with Protease K (100 μg/mL) for 30 min and RNA was isolated with TRIzol reagent from beads. Retrieved RNAs were subjected to Q-PCR detection.

Quantitation of intracellular d-lactate and l-lactate

Intracellular d-lactate and l-lactate were measured by PicoProbeTMd-lactate Assay Kit (Fluorometric) (Abcam, ab174096) and PicoProbeTMl-lactate Assay Kit (Fluorometric, High Sensitivity) (Abcam, ab169557), respectively. Each cell sample (2 × 106) was washed in ice-cold PBS 3 times and then lysed by Assay Buffers. Homogenates were then centrifuged at 12,000 rpm for 10 min at 4 °C and supernatants were collected for subsequent assay. According to the manufacturer’s protocol, the Reaction Mix and Background Control Mix were prepared for each reaction. Next, 50 µL of each sample was added to wells, and 50 µL of the Reaction Mix or Background Control Mix was added and mixed with the contents of each well. The reaction was then incubated for 30 min at 37 °C (d-lactate assay) or room temperature (l-lactate assay) and protected from light. Sample fluorescence (Ex/Em = 535/587 nm) was measured in a microplate reader with kinetics mode, and the concentration of sample d-lactate was calculated according to the standard curves.

Quantitation of cellular MGO

Cellular MGO was measured by Methylglyoxal Assay Kit (BiotechPack Analytical, BKWB69). Cell samples (2 × 106) were lysed by adding extraction solution from the kit with ultrasonication. Samples were then centrifuged for 10 min at 4 °C, 13,000 rpm. Cleared supernatants were transferred to new microcentrifuge tubes. According to the manufacturer’s instructions, the absorbance of samples and blanks were read at 336 nm, and the concentration of sample MGO was calculated according to standard curves.

Quantitation of cellular reduced glutathione (GSH) and oxidized glutathione (GSSG)

Cellular GSH and GSSG were measured by Glutathione Assay Kit (S0053, Beyotime) according to the manufacturer’s instructions. Briefly, Haghfl/fl or Hagh−/− mouse BMDMs were obtained and then lysed by twice quick freezing in liquid nitrogen and heating in a 37 °C water bath. And protein was precipitated and removed by adding buffer M and then centrifuged at 10,000 rpm for 10 min. For the quantitation of total GSH, cell lysates were directly mixed with the reaction buffers (made up according to the manufacturer’s instructions) and then incubated for 5 min at 25 °C; For the quantitation of total GSSG, GSH clear buffer was first added into cell lysates followed by incubated for 60 min at 25 °C, and then lysates mixed with the reaction buffers and incubated for 5 min at 25 °C. The absorbance of samples and blanks was read at 412 nm, and the concentration of sample GSH and GSSG were calculated according to the standard curves.

Quantitation of SLG by LC–MS

Mouse macrophages or PBMCs were lysed in lysis buffer (0.5% NP-40, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl), then samples were centrifuged for 10 min at 4 °C,13,000 rpm. Protein was precipitated by adding 20% (w/v) 5-sulfosalicylic acid (2% final) and removed via centrifugation at 10,000 rcf for 5 min at room temperature. Next, 100 uL of methanol was added to 100 µL cleared supernatant, then samples were ultrasonicated for 30 min at 4 °C and stood for 30 min at 4 °C. Then samples were centrifuged for 15 min at 4 °C, 12,000 rpm, and prepared for LC/MS detection. For LC separation, 6 µL of clarified supernatant was chromatographed using Waters Acquity UPLC equipped with an Acquity UPLC HSS Amide (1.7 µm, 2.1 mm × 100 mm) at a flow rate of 0.30 mL/min at the temperature of 40 °C with Solvent A (10 mM Ammonium in H2O) and Solvent B (Acetonitrile). MS was performed using an AB SCIEX 5500 Qtrap-MS under the following conditions: Ion source: ESI; Curtain Gas: 35 arb; Collision GAS: 9 arb; IonSpray voltage: 4500 V; Temperature: 400 °C; Ion Source Gas1: 45 arb; Ion Source Gas2: 45 arb. For quantitation of SLG, MultiQuant software was used for integration and an SLG standard curve was used for calculation.

Antibody-enriched lysine lactylation identification (lactylome profiling) by TimsTOF LC–MS/MS

Mouse macrophages (1 × 107) treated with VSV (V) or a medium control (C) were separately harvested and sonicated three times on ice using a high-intensity ultrasonic processor (Scientz) in lysis buffer (8 M urea, 0.5% protease inhibitor, 3 μM TSA and 50 mM NAM). Then lysates were centrifuged at 4 °C 13,000 rpm for 15 min. The supernatant was collected and the protein concentration of the extracts was measured using the bicinchoninic acid assay. Next, trypsin digestion, enrichment of lactylation peptides, and mass spectrometer detection were performed by PTMbio according to PTMbio’s standard protocol.

Briefly, for trypsin digestion, 2% trypsin was added for overnight digestion. Peptides were reduced with 5 mM dithiothreitol for 30 min at 56 °C and alkylated with 11 mM iodoacetamide for 15 min at room temperature in darkness. For enrichment of lactylated peptides, tryptic peptides were dissolved in NETN buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, 0.5% NP-40, pH 8.0), and were incubated with anti-Lactyllysine antibody-conjugated agarose beads (PTM-1404, PTMbio) at 4 °C overnight. After elution of peptides, the peptides were desalted with C18 ZipTips (Millipore) according to the manufacturer’s instructions. For mass spectrometer detection, peptides were separated on a nanoElute UHPLC system (Bruker Daltonics), followed by timsTOF Pro (Bruker Daltonics) mass spectrometry. Precursors and fragments were analyzed at the TOF detector with an MS/MS scan range from 100 to 1700 m/z. Precursors with charge states 0–5 were selected for fragmentation.

For identification and relative quantification of lactylation sites, the MS/MS spectra data were analyzed by MaxQuant software (v.1.6.15.0).56 Tandem mass spectra were searched against the mouse SwissProt database. Trypsin/P was specified as a cleavage enzyme allowing up to 2 missing cleavages. The mass tolerance for precursor ions was set as 20 ppm in the first search and 5 ppm in the main search, and the mass tolerance for fragment ions was set as 0.02 Da. Carbamidomethyl on Cys was specified as a fixed modification. Acetylation on protein amino-terminus, oxidation on Met, and Lactylation on Lys were specified as variable modifications. FDR was adjusted to < 1%. Label-Free quantification mode was set as LFQ. The “LFQ min. ratio count” was set as 2. The “LFQ min. number of neighbors” was set as 3, and the “LFQ max. Number of neighbors” was set as 6. The “Label min. ratio count” was set as 2. Peptides for quantification were set as “Unique + Razor”. Acetylation on protein amino-terminus and oxidation on Met were specified as modifications used in protein quantification, and unmodified counterparts were discarded for protein quantification.

Based on the signal intensity value of each peptide in different samples from searching results, the relative quantitative value of the lactylation site is calculated through the following steps: First, the signal intensity (I) of the modified peptide in different samples is transformed to obtain the relative quantitative value (R) of the modified peptide in different samples. The calculation formula is as follows: (i represents the sample, j represents the peptide)

Furthermore, the relative quantitative value of the lactylation site is divided by the relative quantitative value of the protein corresponding to the modification site to eliminate the influence of protein expression levels in different samples.

Lysine acylation analysis of the proteome data from mouse macrophages

Protein extraction and trypsin digestion protocols are described above in the section “Antibody-enriched lysine lactylation identification by TimsTOF LC–MS/MS”. The peptides were desalted with C18 ZipTips (Millipore) according to the manufacturer’s instructions. Then peptides were separated into 30 fractions by HPLC and analyzed using a Q-Exactive Orbitrap Mass Spectrometer. For analysis of different types of lysine acylation sites, the MS/MS spectra data were processed using pFind 3.1 software.57 Tandem mass spectra were searched against the mouse SwissProt database. Trypsin/P was specified as a cleavage enzyme allowing up to 3 missing cleavages. The mass tolerance for precursor and fragment tolerance was set to 20 ppm. Carbamidomethyl on Cys was specified as a fixed modification and indicated types of lysine acylation on Lys were specified as variable modifications. FDR was adjusted to < 1%, open search was set as none, and quantification was set as none.

In vitro SLG-induced protein d-lactylation reactions

Different concentrations of SLG (L7140, Sigma-Aldrich) (0 mM, 0.05 mM, 0.25 mM, 1 mM, 1.25 mM, 5 mM, 25 mM) were prepared in TBS buffer (50 mM Tris-Cl, pH 8.0, and 150 mM NaCl) solutions. For reactions examining BSA lactylation, 2 μg/μL solutions of fatty acid-free BSA (A1933, Sigma-Aldrich) were made in TBS. Samples were heated at 95 °C for 15 min for denaturation while control samples were placed on ice for 15 min. When all samples had returned to room temperature, 10 uL of SLG was added to 40 uL of each BSA solution to a final concentration of 0 mM, 0.01 mM, 0.05 mM, 0.2 mM, 0.25 mM, 1 mM, or 5 mM respectively, and samples were incubated for 4 h at 37 °C at 400 rpm in an Eppendorf Thermomixer. Next, the samples were boiled with protein loading buffer for 5 min and then subjected to SDS-PAGE. The level of lactylation was detected by immunoblotting. The input BSA was confirmed by Coomassie brilliant blue R-250 staining.

To measure macrophage lysate protein lactylation, 5 × 106 mouse macrophages were harvested and lysed in 600 uL Lysis Buffer (0.5% NP-40, 50 mM Tris-Cl, pH 8.0, and 150 mM NaCl) supplemented with Protease inhibitor. 40 uL of supernatants were transferred to different tubes according to different reaction conditions. For the control group, samples were placed on ice. For heat denaturation groups, samples were heated at 95 °C for 15 min. For the DTT-pretreated group, samples were reduced with 5 mM dithiothreitol (A620058, BBI) for 30 min at 56 °C and then placed on ice. For the cysteine alkylation group, samples were reduced with 5 mM dithiothreitol for 30 min at 56 °C and then alkylated with 10 mM iodoacetamide (A600539, BBI) for 15 min at room temperature in darkness. SLG co-incubation and detection of lactylation were the same as for the BSA experiment above.

Assay of SLG-induced d-lactylation on peptides in vitro

WT or mutated peptides from mouse IFIT3 were synthesized by Genscript, and 20 ug of each peptide was dissolved in 200 μL TBS (50 mM Tris-Cl, pH 8.0, and 150 mM NaCl) solutions respectively for each reaction. For the SLG treatment group, peptides were treated with 1 mM of SLG (L7140, Sigma-Aldrich) for 4 h at 37 °C at 400 rpm in an Eppendorf Thermomixer. For the group of cysteine alkylation, peptides were alkylated with 10 mM iodoacetamide (A600539, BBI) for 15 min at room temperature in darkness and then treated with 1 mM of SLG for 4 h at 37 °C at 400 rpm in an Eppendorf Thermomixer. Next, peptide lactylation was detected by LC–MS (Agilent 1200 system), and lactylation sites were identified by LC–MS/MS (Q-Exactive HF-X, Thermo Fisher). MS/MS spectra were analyzed using pFind 3.1 software.

Distance calculation of lysine ε-amine group to the spatial nearest cysteine β-thiol in the whole proteome

The PDB structure files of the entire proteome were downloaded from the Alphafold database. Python was then used to analyze the PDB files of a given protein. Briefly, we used an “For” loop to walk through each row of the PDB files to find the position of a Lys. The spatial position of the ε-amino group was found in information for the specific Lys. Then, we similarly defined the positions of all Cys groups in the protein and their sulfhydryl groups. The spatial distance between the specific ε-amino and the sulfhydryl was calculated, and the shortest distance and its corresponding Cys were recorded. This distance was defined as the KC distance to the specific Lys site. Codes of KC distance analysis in Python can be obtained upon request to the corresponding author.

Expression of a site-specific lactylated protein by genetic code expansion with an orthogonal system

The pEF1-Mm (LacK PylRS) plasmid expressing lacyl-tRNA synthetase and tRNA pairs was kindly provided by Prof. Tao Peng (School of Chemical Biology and Biotechnology, Peking University Shenzhen Graduate School), and Flag-tag of lacyl-tRNA synthetase protein was changed to Myc-tag. For expression of site-specific lactylated RelA protein, briefly, a plasmid expressing Flag-RelA containing an amber TAG codon mutation in the K310 site and pEF1-Mm (LacK PylRS) plasmid were co-transfected into HEK-293T cell by JetPei DNA transfection reagents (101000020, PolyPlus). The indicated concentration of lactyllysine was then added to the cell medium. After transfection for 24 h, cells were harvested and lysed in 400 uL Cell Lysis Buffer supplemented with protease inhibitor (539134-1SET, Merck). After centrifugation (13,000 rcf, 10 min, 4 °C), expression of lactylated RelA was detected by immunoblotting, and lysate supernatants were incubated with anti-Flag M2 magnetic beads (M8823, Merck) (rotating at 4 °C for 4 h). Lactylated RelA proteins were eluted by adding 100 ng/µL 3× Flag peptides and then used for the indicated experiments.

ChIP

2 × 107 HEK-293T cells overexpressing WT or mutated RelA were crosslinked with 1% formaldehyde for 15 min at 37 °C. Crosslinking reactions were quenched with 0.125 M glycine for 5 min at room temperature. Cells were lysed (1% SDS, 50 mM Tris-HCl, pH 8.0, 5 mM EDTA, and protease inhibitors) and sonicated to obtain DNA fragments of ~300–500 bp in length on average. Samples were then centrifuged at 14,000 rpm for 10 min at 4 °C. The supernatant was diluted (20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100, 150 mM NaCl, and protease inhibitors) and then incubated with 30 μL Flag M2 magnetic beads (M8823, Merck) overnight at 4 °C. Beads were then washed sequentially with TSE I (0.1% SDS, 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100, 150 mM NaCl and protease inhibitors), TSE II (0.1% SDS, 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100, 500 mM NaCl and protease inhibitors), LiCl buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.25 mM LiCl, 0.1% NP-40 and 1% deoxycholate sodium) and TE (10 mM Tris-HCl, pH 8.0 and 1 mM EDTA, pH 8.0). The mass of bound proteins in beads was detected by SDS-PAGE and immunoblotting and then quantified by ImageJ. Beads binding the same mass as the protein–DNA complex were eluted with 400 μL of fresh elution buffer (25 mM Tris-HCl, pH 8.0, 10 mM EDTA, and 0.5% SDS) at 65 °C for 15 min. Crosslinking of protein–DNA complex and whole-cell extract-DNA was reversed by overnight incubation at 65 °C with 200 mM NaCl. The retrieved rate of immunoprecipitated DNA was analyzed by qRT–PCR.

BLI kinetic binding studies

NF-κB DNA sequence with 5′ biotin-TEG modification was synthesized by Sangon Biotech Co. (Shanghai, China). Flag-tagged WT, K310R, and K310L RelA proteins were each overexpressed in HEK-239T cells and immunoprecipitated using anti-Flag M2 magnetic beads (M8823, Merck). Proteins were eluted with 3× Flag peptides (200 μg/mL) and concentrated by ultrafiltration. The protein concentration was quantified using a BCA assay and then adjusted to the same concentration for the next BLI kinetic binding assays. BLI analysis was performed using the Octet Red 96 system (Starorius). Briefly, biotin-modified NF-κB sequences were loaded onto Streptavidin Biosensors at 1000 rpm for 180 s. WT or K310L RelA proteins diluted to the indicated concentrations were associated with loaded sensors at 1000 rpm for 300 s and dissociated for another 300 s. The data were analyzed using Octet Data Analysis Software version 9.0.0.14.

Co-immunoprecipitation and endogenous co-immunoprecipitation

Control vectors, WT, or mutated Flag-RelA expressing vectors were transfected in HEK-293T cells (2 × 106) by JetPei DNA transfection reagents (101000020, PolyPlus). After transfection for 24 h, cells were harvested and lysed by 400 uL Cell Lysis Buffer supplemented with protease inhibitor (539134-1SET, Merck). After centrifugation (13,000 rcf, 10 min, 4 °C), lysate supernatants were incubated with 20 uL anti-Flag M2 magnetic beads (M8823, Merck) (rotating at 4 °C for 4 h). Beads were then washed three times in buffer and co-incubated with 50 uL 1 mM SLG in the reaction buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0) or buffer alone (control) with rotation at 37 °C for 3 h. After SLG incubation and washing, the mass of binding Flag-RelA proteins was detected and quantified by immunoblotting followed by imageJ analysis. According to the result of quantitation, the beads binding with the same mass of three types of RelA proteins were co-incubated respectively with 400 uL of macrophage lysate supernatants (rotating at 4 °C for 4 h). Beads were washed with wash buffer three times, boiled in protein loading buffer for 5 min, and subjected to SDS-PAGE and immunoblotting analysis.

For endogenous immunoprecipitation of macrophage RelA proteins, mouse macrophages (1 × 107) treated with VSV, LPS, or a medium control were separately harvested using 1 mL cell lysis buffer (Cell Signaling Technology). Then lysates were centrifuged at 4 °C 13,000 rpm for 15 min. The supernatant was collected and the protein concentration of the extracts was measured using the bicinchoninic acid assay. To reduce nonspecific binding, lysates were incubated with 500 uL protein A magnetic beads for 2 h. Next, 10 μL of RelA (NF-κB p65) antibodies (8242, Cell Signaling Technology) were added separately into lysates and incubated overnight at 4 °C, and then protein–antibody complex was incubated with 200 uL protein A magnetic beads at room temperature for 30 min. Beads were washed with wash buffer three times, boiled in protein loading buffer for 5 min, and subjected to SDS-PAGE and immunoblotting.

Dual-luciferase reporter assays

HEK-293T cells (1 × 105) were cultured in 96-well plates. 20 ng of WT or mutated RelA vector, 100 ng of NF-κB pGL4-Photinus pyralis reporter vector, 10 ng of pGL4-Renilla reniform control vector, and 8 ng or 16 ng of IκBα vector was mixed according to the experimental design. The vector mixture was transfected into HEK-293T cells by JetPei DNA transfection reagents (101000020, PolyPlus). After transfection for 12 h, 0.4 μM of DiFMOC-G was added to each well. After transfection for 36 h, cells were harvested and lysed using Passive Lysis Buffer (E1941, Promega) with shaking for 400 rpm at room temperature for 1 h. Fluorescence intensity was detected using the Dual-Luciferase® Reporter Assay System (E1910, Promega) according to the manufacturer’s instructions.

Enzyme-linked immunosorbent assay (ELISA)

The concentrations of mouse IFNβ, IL-6, or TNFα in cell culture supernatants or serum were measured using the IFNβ cytokine specific VeriKine ELISA kit (PBL Interferon Source), IL-6 Quantikine ELISA kit (R&D Systems), or TNFα Quantikine ELISA kit (R&D Systems) respectively, according to the manufacturer’s instructions.

Cytometric Bead Array System (CBA) detection of cytokines

The concentrations of human IL-6, TNFα, or IL-1β in the PBMC cell medium were measured using Human IL-6 Flex Set (558276, BD), Human TNF Flex Set (558273, BD), and Human IL-1β Flex Set (558279, BD), respectively, and detected with the ID7000 Spectral Cell Analyzer (SONY) according to the manufacturer’s instructions. The statistical significance of comparisons between the two groups was determined with a ratio-paired t-test.

Flow cytometry assay

To examine the viability and differentiation of mouse BMDM, HAGHfl/fl or HAGH−/− BMDMs were harvested on culture day 7. Macrophage markers were stained with fluorophore-conjugated CD11b (101235, Biolegend) and F4/80(123115, Biolegend). To examine the proportion and quantity of immune cell subsets in mouse spleen, HAGHfl/fl or HAGH−/− solenocytes were harvested and then stained with fluorophore-conjugated CD11b (101235, Biolegend), CD3 (553062, BD), CD4 (563151, BD), and CD8 (557959, BD).

For the assay of human T-cell activation, Human PBMCs (3 × 105) were cultured in 96-well plates, and 0.4 μM of DiFMOC-G was added to each well for 12 h. Then 100 ng/mL PMA (P8139, Sigma-Aldrich), 1 μg/mL of ionomycin (HY-13434, MedChemExpress), and 3 μg/mL of Brefeldin A Solution (00-4506-51, Invitrogen) were added to the medium for 5 h. For the flow cytometry assay, T-cell markers were stained with fluorophore-conjugated CD3 (561806, BD), CD4 (557852, BD), and CD8 (562282, BD) antibodies. After cell fixation and permeabilization (554714, BD), cytoplasmic IFNγ was stained with fluorophore-conjugated antibody (551385, BD). All samples were assayed with the BD LSR Fortessa flow cytometer, and the data were analyzed by FlowJo software (10.8.1).

siRNA knockdown of GLO2 and TTP

10 nM siRNA was transfected into the indicated cells using the INTERFERin® reagent (Polyplus) according to standard procedures. 48 h after transfection, cells were detected or treated as indicated. The mouse GLO2-specific sequence (designed and synthesized by RIBOBIO) 5′-UUU CGC AGC UUC UAU UUC C-3′ was used for siRNA-1, 5′-AGU UUC UCU UGA AUG GCA G-3′ was used for siRNA-2. 5′ -UUG UAC AUC UCA UCU GCA G-3′ was used for siRNA-3. The mouse TTP-specific sequence (designed and synthesized by GenePharma) 5′-GCU CCU UCA AGU UGU GAA ACG-3′ was used for siRNA-TTP. The untargeted sequence 5′-UUC UCC GAA CGU GUC ACG U-3′ was used as a negative control.

SARS-CoV-2 infection mouse model

K18-hACE2 mice, aged 6 weeks, were intranasally injected with 105 TCID50 of SARS-CoV-2 Omicron (B.1.1.529). After infection for 3 days, the mice were euthanized and tissues (spleen, lung, and brain) were collected. Total RNA was extracted with TRIzol (Life technology), and RNA was reverse transcribed into cDNA with the High Efficient Reverse Transcriptase Kit (Toyobo). Levels of RNA expression were quantified by Q-PCR. All experiments were performed in BSL-3 laboratories and approved by the Institutional Committee for Animal Care and Biosafety of the Second Military Medical University.

Inflammatory and acute infection mouse model

For the experiments on GLO2-knockout mice, 8-week-old C57 B6/L mice were i.p. injected with VSV (1 × 107 pfu/g) or LPS (80 μg/g). 12 h later, whole blood was collected from the orbital venous plexus. H&E staining of lung tissue was performed 24 h after injection. For the survival assay, mice were kept for 72 h after challenging and then euthanized, n = 6.

For DiFMOC-G treatment, 80 or 800 mg/kg of DiFMOC-G was i.p. injected into 8-week-old C57 B6/L mice 12 h before the infection. Then mice were i.p. injected with VSV (1 × 107 pfu/g), LPS (80 μg/g), or i.v. injected with Poly (I:C) (20 μg/g). Whole blood was collected 12 h after the last administration from the orbital venous plexus. For the survival assay, mice were kept for 72 h after challenging and then euthanized. The number of mice used in each group is listed as follows. For VSV challenge, n = 7; for LPS treatment, nDMSO = 12, n80mg/kg DiFMOC-G = 11, n800mg/kg DiFMOC-G = 5; for of Poly (I:C) challenge, nDMSO = 5, nDiFMOC-G = 7. Survival analysis was determined using the Log-rank (Mantel-Cox) test.

TNBS-induced colitis mouse model

6-week-old Balb/c mice were used for the TNBS-induced colitis model. First, each mouse was weighed and marked before other operations. Then the mouse was anesthetized by i.p. injection of Pelltobarbitalum Natricum (50 mg/kg), and a catheter was fitted to a 1 mL syringe and 2.5% TNBS solution (MB5523, Meilunbio) (water: alcohol = 1:1 solution) was filled. The catheter was inserted into the colon 4 cm proximal to the anus, and 100 mL of TNBS solution was slowly administered into the colon lumen. The catheter was removed gently from the colon and the mouse kept its head down in a vertical position for 60 s. Then, 800 mg/kg of DiFMOC-G in normal saline solution or the same volume of normal saline was i.p. injected into mice, and the same dose of DiFMOC-G was administered once every 48 h. Body weights, H&E staining of colon tissues, and survival ratio were analyzed at the indicated time point after TNBS treatment. Mice were euthanized 5 days after TNBS treatment.

Statistical analysis

All statistical analyses were performed using GraphPad Prism 9.0 software. Error bars in Q-PCR experiments, cytokine levels, metabolite levels, and enzymatic activity results represent the standard deviation of three or more independent experiments. Data from imaging experiments are representative of three or more independent experiments. Unless noted otherwise, immunoblots are representative of at least three independent experiments. For in vivo data and human data, points represent individual mice or samples from individual donors. The statistical significance of comparisons between the two groups was determined with Student’s t-test. The significance of different groups was determined using a one-way or two-way ANOVA as appropriate. Survival analysis was determined with the Log-rank (Mantel-Cox) test. P-values of less than 0.05 were considered statistically significant. ns (non-significant) means P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.