This study was performed entirely in mice using either commercially available transgenic mice or novel transgenic mice generated as described below. All mice used in this study were maintained on a C57BL/6 background. For ectopic expression of the muscle fusogens, doxycycline-inducible transgenes, TRE3G-Myomaker-IRES2-Cre-pA, and TRE3G-Myomerger-IRES2-Cre-pA were targeted into the Col1a1 safe harbor (CaSH) locus using a CRISPR/Cas9-mediated approach developed by Transgenic Animal and Genome Editing Core at Cincinnati Children’s Hospital Medical Center. The transgenes were inserted to a genetic location ~ 1.65 kb downstream of the Col1a1 gene in a reverse orientation. This was achieved using a sgRNA (target sequence: GGGAGGAAACCTGCCCTTGG) and a donor plasmid containing the transgene flanked with the 5′ and 3′ homologous arms at the length of 2.5 kb and 3.0 kb, respectively. The donor plasmids were amplified and purified with the EndoFree Plasmid Kit (Qiagen). The targeted transgenic mice were generated via pronuclear injection of fertilized C57BL/6 eggs with Cas9 protein (IDT, Catalog no. 1081059), synthetic sgRNA (Synthego), and the donor plasmid at a concentration of 40 ng/µl, 20 ng/µl, and 4 ng/µl, respectively. The injected eggs were transferred immediately into the oviductal ampulla of pseudopregnant CD-1 females for development and birth. The pups were then genotyped by long-range PCR and Sanger sequencing. These mice (Col1a1TRE−Mymk IRES−Cre and Col1a1TRE−Mymg IRES−Cre) were crossed with mice carrying the HSArtTA allele to drive fusogen expression in the myofiber compartment [21]. Dual expression of Myomaker and Myomerger was generated by breeding the Col1a1TRE−Mymk IRES−Cre mice with Col1a1TRE−Mymg IRES−Cre mice, followed by breeding with the HSArtTA mouse. Myofiber-specific deletion of Mymk in the dystrophic background was accomplished by introducing an HSACreERT2 allele into the MymkloxP/loxPmdx4cv mouse [18, 49].

To induce fusogen expression in myofibers, 1- to 2-month-old mice were provided chow supplemented with 0.0625% doxycycline (TestDiet). Tissue was collected immediately upon completion of doxycycline treatment.

Tamoxifen (MilliporeSigma) was prepared in corn oil with 10% ethanol at a concentration of 25 mg/mL. Mice were given intraperitoneal injections of tamoxifen (0.075 mg/kg/d) for 4 days to induce recombination. For experiments with the HSACreERT2 allele, mice were then maintained on tamoxifen by injection every third day.

AAV9-GFP and AAV9-Myomerger were generated by Vigene Biosciences and intramuscularly injected (5 × 1011 genome copies/injection, diluted with sterile PBS) into the TA muscle of 2-month-old mice while under inhaled isoflurane anesthesia. The injection site was prepared by first removing hair with hair clippers and then sanitizing the area with chlorhexidine gluconate and allowing it to dry.

Mouse hindlimb muscles were dissected, dried, and weighed. Tibias were dissected, and remaining tissue was digested with proteinase K (0.4 mg/mL) overnight at 55 °C, after which tibia length was measured using digital calipers. Muscles were embedded in 10% tragacanth/PBS (MilliporeSigma) and frozen in 2-methylbutane cooled in liquid nitrogen. We used 10-μm sections for all histology. For RNA and immunoblot preparations, tissues were flash frozen in liquid nitrogen immediately upon collection.

Immunohistochemical studies were performed as described previously with minor modifications [18]. Briefly, sections were fixed in 1% PFA/PBS and permeabilized with 0.2% Triton X-100/PBS. Sections were blocked using 2% BSA, 1% heat-inactivated goat serum, and 0.1% Tween-20/PBS. Primary antibodies were incubated overnight at 4 °C, and secondary Alexa Fluor antibodies (1:300) were applied at room temperature for 30 min. Anti-laminin antibody (1:300, MilliporeSigma, stock no. L9393) was used to visualize the outline of all myofibers present in each muscle section. IgM primary antibody conjugated to Texas Red (1:100, MilliporeSigma, stock no. SAB3701210) was used to highlight myofibers with compromised membrane integrity. Anti-ESGP antibody (1:100, R&D, stock no. AF4580) was used to stain Myomerger protein on muscle sections. Immunostained slides were imaged using a Nikon A1R confocal system. Centrally located myonuclei were quantified from two 10 × images using ImageJ (NIH). IgM-positive myofibers and myofiber size were quantified from the entire muscle section using NIS-Elements software (Nikon).

Picrosirius red staining was used to quantify muscle fibrosis. Briefly, fresh-frozen sections were incubated overnight in Bouin’s solution. After a 5-min wash in PBS, sections were incubated in working Weigert’s hematoxylin for 5 min before a 1-h incubation in picrosirius red. Sections were dipped two times in 0.5% acetic acid and three times in ethanol. Three 1-min exchanges in xylenes were performed before mounting. Picrosirius red-stained sections were imaged using an Olympus BX60 widefield microscope. Fibrosis was quantified from two 10 × images using ImageJ (NIH).

Gross pathology was assessed with hematoxylin and eosin (H&E) staining. Fresh-frozen sections were incubated in 10% formalin for 5 min before washing in PBS for 2 min followed by a 2-min wash in tap water. After incubating sections in working Weigert’s hematoxylin for 5 min, they were rinsed with tap water until tap water ran clear. Sections were dipped ten times in 0.7% eosin Y, ten times in 95% ethanol, ten times in 95% ethanol, ten times in 100% ethanol, ten times in 100% ethanol, ten times in xylene, ten times in xylene, and ten times in one last xylene solution before mounting. H&E stained sections were imaged using an Olympus BX60 widefield microscope. All image analyses were performed in a blinded fashion.

Total RNA was isolated from muscle samples using established TRIzol protocols (Life Technologies, stock no. 15596018). cDNA was synthesized with the Superscript VILO cDNA Synthesis Kit (Invitrogen, Thermo Fishers Scientific, stock no. 11754250). Standard qPCR methods were used with PowerUp SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific), and the assay was performed on the Bio-Rad CFX96 Real-Time System with the following primers: GAPDH: forward, 5′-TGCGACTTCAACAGCAACTC-3′; reverse, 5′-GCCTCTCTTGCTCAGTGTCC-3′, Mymk: forward, 5′-ATCGCTACCAAGAGGCGTT-3′; reverse, 5′-CACAGCACAGACAAACCAGG-3′, and Mymx: forward, 5′-CAGGAGGGCAAGAAGTTCAG-3′; reverse, 5′-ATGTCTTGGGAGCTCAGTCG-3′. mRNA levels were quantified using the ΔΔCt method [50].

After measuring the mass, muscles were homogenized in muscle lysis buffer (10-mM Tris, 1-mM EDTA, 0.5% Triton X-100, and 50-mM NaF buffer, pH 7.4) supplemented with a protease inhibitor cocktail (Sigma Aldrich, stock no. 5056489001). Solubilization was allowed to proceed on a nutator for 2 h at 4 °C. Protein lysates were prepared for SDS-PAGE analysis by heating at 95 °C for 5 min in 1 × Laemmli sample buffer containing 10% beta-mercaptoethanol. Proteins were resolved on discontinuous polyacrylamide gels (12% for Myomaker and 15% for Myomerger) and transferred to Immobilon-FL PVDF membranes (Millipore Sigma, stock no. IPFL00010). Membranes were blocked in 5% milk/TBST for 1 h at room temperature before incubation with primary antibodies in 5% BSA/TBST against Myomaker (1:250, provided from Dr. Leonid Chernomordik laboratory), Myomerger (1:200, R&D, stock no. AF4580), and GAPDH (1:5000, Millipore, stock no. MAB374) overnight on a nutator at 4 °C. The resulting immunoblots generated after incubation with relevant secondary antibodies (goat anti-rabbit IgG DyLight 800, Cell Signaling Technology, stock no. 5151; donkey anti-Sheep IgG Alexa Fluor 680, Invitrogen Thermo Fisher Scientific, stock no. A21102; goat anti-mouse IgG DyLight 680, Cell Signaling Technology, stock no. 5470; goat anti-mouse IgG Dylight 800, Cell Signaling Technology, stock no. 5257) were scanned, imaged, and analyzed using the Odyssey CLx imaging system (LI-COR Biosciences, stock no. 9140). Protein expression was quantified using densitometric analysis tools on ImageJ (NIH). The band intensities of Myomaker and Myomerger were measured and standardized to the intensity of the housekeeping gene, GAPDH.

Serum creatinine kinase levels were measured using a Roche c 311 clinical chemistry analyzer per manufacturer instructions.

Atomic force microscopy was used to measure stiffness of single muscle fibers. For isolation of single muscle fibers, whole EDL muscles were incubated in 0.22% type 1 collagenase (MilliporeSigma C0130) in DMEM at 37 °C for 40 min. Following incubation, muscles were triturated in PBS to release individual myofibers. The myofibers were subsequently washed with PBS before fixing in 4% PFA/PBS for 10 min at room temperature, after which the fixed fibers were washed again with PBS and stored at 4 °C. Fixed myofibers were placed on double-sided tape applied to the bottom of 60-mm plates. The plates were centrifuged at 400 g for 10 min at room temperature to attach the myofibers to the tape [29]. Attached myofibers were submerged in 0.22-µm-filtered PBS prior to measurement by AFM. Stiffness was quantified using the contact mode of force mapping on a NanoWizard 4 XP BioScience atomic force microscope with a HybridStage (Bruker). A Nikon Eclipse Ti-U inverted microscope permitted precise positioning of the cantilever tip above the myofiber. Before each experiment, the cantilever was calibrated while submerged in PBS in a region of the dish that did not contain a myofiber nearby. A z-closed loop with constant force, 0.05-nN set point, 1.0-μm z length, 2.0 μm/s z speed, and 0.0-s contact time, was used to make sixty-four measurements were collected from a 10 × 10 µm area of the myofiber. The calibrated spring constant of cantilever D was used to convert the photodiode signal into a force value (knom = 0.03 N/m, MLCT-BIO; Bruker). Young’s modulus was extracted from each force-indentation curve using a modified Hertz model with the Bilodeau formula for a quadratic pyramidal indenter [51]:

$$F=0.7453\frac^}^\mathrm\,\alpha,$$

where F is the indentation force, E is Young’s modulus, v is Poisson’s ratio (approximated as 0.5, the value for isotropic incompressible materials), δ is the indentation (vertical tip position), and α is the half face angle of the pyramid (17.5° for cantilever D). The equivalent radius of a contact circle was calculated as the following:

$$_=0.709\delta \mathrm\,\alpha,$$

where ae is the equivalent radius of contact circle, δ is the indentation (vertical tip position), and α is the half face angle of the pyramid (17.5° for cantilever D). The data curve was fitted using a least squares fit with the Levenberg–Marquardt algorithm. The contact point, baseline, and Young’s modulus values were all fitted simultaneously. Measurements were taken at three different locations and averaged to yield the stiffness of a given myofiber. The mean stiffness of three unique myofibers comprised the myofiber stiffness for a given mouse.

All statistical analysis was performed using GraphPad Prism 9 software. Data are presented as mean ± standard error of the mean. Groups were assessed for normality using a Shapiro–Wilk test and analyzed using a one-way ANOVA with post hoc Tukey’s for multiple comparisons. Significant differences between two groups were determined using a two-tailed unpaired Student’s t-test. Statistical significance throughout was set at P-values less than 0.05. Specific statistical tests are noted in the figure legends.