Megf10tm1b(KOMP)Jr mice [15] with homozygous knockout of the fourth exon are referred to as Megf10 KO mice. S100β-GFP (B6;D2-Tg(S100b-EGFP)1Wjt/J) [16] and NG2-DsRed mice (Tg(Cspg4-DsRed.T1)1Akik/J) [17] were purchased from Jackson Labs (Bar Harbor, ME) and crossed to generate S100β-GFP; NG2-DsRed mice. Juvenile mice were 1 month old, young adult mice were 3–7 months old, and middle-aged mice were 10–14 months old, with the particular ages of mice used for each experiment described in the figure legends. For some experiments, Megf10 KO mice were raised and sacrificed at Duke University and then shipped to Brown University for analysis. Other Megf10 KO mice were bred, raised, and analyzed at Brown University. S100β-GFP; NG2-DsRed mice were raised and sacrificed at Brown University. All of the mice housed at Duke University or Brown University were housed in a 12 h light-dark cycle with ad libitum access to water and food. All experiments were carried out under NIH guidelines and those of the Institutional Animal Care and Use Committees of Brown University (Protocol# 22-09-0003) and Duke University (Protocol# A211-21-10).

Antibodies used for immunohistochemistry (IHC) include: rabbit anti-synaptophysin antibody (1:100, Invitrogen, 180,130), rabbit anti-S100β antibody (1:400, Dako, Z0311), mouse IgG1 anti-neurofilament antibody (1:400, DSHB, 2H3-s), mouse IgG1 anti-SV2 antibody (1:400, DSHB, SV2- s), mouse IgG1 anti-NeuN antibody (1:500, Millipore Sigma, MAB377), guinea pig anti-VAChT antibody (1:1000, Millipore Sigma, AB1588), Alexa Fluor 488 conjugated polyclonal goat anti-mouse IgG1 (1:500, Thermo Fisher, A21121), Alexa Fluor 488 conjugated polyclonal goat anti-guinea pig (1:500, Thermo Fisher, A11073), Alexa Fluor 555 conjugated polyclonal goat anti-mouse IgG1 (1:500, Thermo Fisher, A21127), and Alexa Fluor 568 conjugated polyclonal goat anti-rabbit IgG (1:500, Invitrogen, 2,599,544). Alexa Fluor 488 conjugated alpha-bungarotoxin (1:500, Thermo Fisher, B13422) and Alexa Fluor 647 conjugated alpha-bungarotoxin (1:500, Invitrogen, B35450) were used to label nAChRs. Rhodamine-WGA (1:500, Vector Laboratories, RL-1022) was used to outline muscle fibers in cross section. DAPI (1:1000, Thermo Fisher, D1306) was used to label nuclei.

Muscles were dissected from mice following transcardial perfusion with 4% paraformaldehyde. For IHC of muscle cross-sections, tibialis anterior (TA) muscles were incubated in 30% sucrose in PBS overnight at 4 °C, cut in half perpendicular to their length with a razor, embedded in Tissue-Tek OCT compound (Sakura), and cross-sectioned at 16 μm with a cryostat. Muscle cross sections were placed on gelatin-coated glass microscope slides, washed in PBS, incubated in blocking buffer (5% BSA, 3% goat serum in PBS) for 1 h at room temperature and then incubated in WGA-Rhodamine and DAPI in blocking buffer for 1 h at room temperature, washed 3x in PBS, and covered in Vectashield (Vector Laboratories, H- 1000) before coverslip application. For IHC of NMJs, the extensor digitorum longus (EDL), soleus, diaphragm, and triangularis muscles were dissected and some were post-fixed for 1 min in ice-cold methanol and then washed 3x in PBS. Then, all of the muscles were incubated in blocking buffer (5% BSA, 3% goat serum, 0.5% Triton X-100 in PBS) for 1 h at room temperature, incubated in primary antibody diluted in blocking buffer overnight at 4 °C, washed 3x in blocking buffer, incubated in secondary antibody, DAPI and fBTX for 3 h at 4 °C, washed 3x in PBS, and mounted to microscope slides in Vectacshield. For IHC of motor neurons, spinal cords were dissected and immediately post-fixed in 4% paraformaldehyde for 2 h at 4 °C, washed 3x in PBS, incubated in 30% sucrose in PBS overnight at 4 °C, embedded in Tissue-Tek OCT compound, and the lumbar region was cross-sectioned at 50 μm with a cryostat. Spinal cord cross sections were placed on gelatin-coated glass microscope slides, washed in PBS, incubated in blocking buffer (5% BSA, 3% goat serum, 0.1% Triton X-100 in PBS) for 1 h at room temperature, incubated in primary antibody diluted in blocking buffer overnight at 4 °C, washed 3x in blocking buffer, incubated in secondary antibody for 3 h at 4 °C, washed 3x in PBS, and covered in Vectashield before coverslip application.

Confocal images were obtained with a Zeiss LSM 900 laser scanning confocal microscope (Carl Zeiss Microscopy, Berlin, Germany) equipped with 405, 488, 561, and 640 nm lasers using a 20 × (0.8 numerical aperture) or a 63 × (1.4 numerical aperture) objective. Maximum intensity projections and stitching of tile scans were generated using Zeiss Zen Black software.

All confocal image analysis was performed in ImageJ software (version 2.1.0/1.53c). For all analyses, the genotype (and sex, when appropriate) was blinded to the analyst. Muscle fiber analysis was performed on TA cross-sections stained with fWGA/DAPI, with 4 cross sections analyzed per mouse. Muscle fiber number was counted by hand from a single TA cross section. Muscle fiber size and central nuclei prevalence were measured using an average of 355 fibers randomly sampled across the 4 cross sections using the fractionator method [18]. Muscle fiber size was measured by outlining each muscle fiber using the polygon tool in ImageJ to measure minimum Feret’s diameter. These fibers were identified as having a central nucleus if the muscle fiber had at least one DAPI-labeled nucleus within the muscle fiber (i.e. not touching the edge of the fWGA stained muscle fiber).

NMJ presynapse and postsynapse analyses were performed on whole mounted EDL, soleus, and diaphragm muscles stained for synaptophysin and with fBTX labeling of nAChRs. Postsynaptic fragmentation was measured as the number of discrete, non-touching fBTX + nAChR islands per NMJ, with an average of 49 NMJs analyzed per mouse. The following analyses were performed on the diaphragm only, with an average of 12 NMJs analyzed per mouse. Receptor area was determined by measuring the area of fBTX + pixels at a given NMJ following signal thresholding in ImageJ. Dispersion index was captured at the same time in ImageJ by collecting Shape Descriptors which includes Solidity, which is the area of fBTX staining divided by the area of a perimeter around all of the fBTX staining. Junctional area, which is the area of the perimeter around the fBTX + AChR islands, was then derived by dividing the receptor area by the dispersion index. Innervation was determined by measuring the total area of fBTX signal for each NMJ and subtracting the area of fBTX AChRs lacking an apposing synaptophysin + axon terminal (i.e. subtracting the area of denervated AChRs), and then dividing these values. Postsynaptic coverage was determined by measuring the total area of the synaptophysin + axon terminal and subtracting the area of synaptophysin + axon terminal lacking opposing fBTX + AChRs, and then dividing these values.

PSC number and morphology analyses were performed on whole mounted triangularis muscles stained for S100β, SV2, and neurofilament, and with fBTX/DAPI, with an average of 23 NMJs analyzed per mouse. NMJs were selected for imaging that were en face and near the surface of the muscle tissue, as this allows best imaging of NMJ morphology. PSCs were counted per NMJ using the counter tool in ImageJ, being identified as S100β-positive cells with a nucleus/cell body apposed to postsynaptic nAChRs. PSC sprouts were identified as extensions of PSCs away from the NMJ that are at least 3 μm long using the line selection tool in ImageJ, as described previously [5]. Migrating Schwann cells (SCs) were identified as S100β-positive cells that have a cell body which is not apposed to the postsynaptic nAChRs but have sprouts which are both continuous with the rest of the PSC processes over the postsynapse and extending away from the NMJ, as described previously [5].

Motor neuron number and size analyses were performed on lumbar spinal cord cross sections stained for NeuN and VAChT. Measurements were collected from both ventral horns of a single spinal cord cross section per mouse and then averages were taken between them. Alpha motor neurons were counted per ventral horn using the counter tool in ImageJ, identified as large NeuN + cells in the ventral horn of the spinal cord with VAChT + punctae along the soma and dendrites. The large size of alpha motor neurons and their location within the ventral horn was used to distinguish alpha motor neurons from other cholinergic neurons. Soma size was measured per alpha motor neuron using the polygon tool in ImageJ in the Z-slice in which the soma size was greatest, with an average of 20 motor neurons analyzed per mouse. Edge artifacts were avoided for this analysis by only analyzing alpha motor neuron that were fully captured in the Z-stack.

One 6-month-old female wild-type mouse and one 6-month-old female Megf10 KO mouse were perfused transcardially with 0.1 M sodium cacodylate buffer with 2mM calcium chloride and 100mM sucrose at pH 7.4 at room temperature, followed by the same buffer with 2% PFA and 3% glutaraldehyde. The smallest segment of the EDL was immediately dissected and then fixed overnight at room temperature in 2% PFA, 3% glutaraldehyde in buffer. The EDL segments were cut in half perpendicular to their length with a razor blade near the endplate band. The muscle pieces were washed in buffer and then stained in 1% osmium tetroxide (Sigma Aldrich, 75,632), 1% ferrocyanide (Sigma Aldrich, P3289) in buffer for 5 h at room temperature. The muscles were then washed in ddH2O and then stained with 1% uranyl acetate for 2 h at room temperature. Muscles were washed in ddH2O and then dehydrated in graded ethanol at 30%, 50%, 70%, 90%, 95%, and 100% ethanol for 20 min at each step. After three 10-minute washes in 100% ethanol, the muscles were embedded in SPURR Low Viscosity Embedding Kit, Hard Mix (EMS, Cat #14,300). A Leica EM UC7 Ultramicrotome was used to trim the blocks with a razor blade and then a diamond knife, and then a diamond knife was used to obtain approximately 20 100 nm cross sections per sample. Then, to sample at different depths within the tissue and image different NMJs, 45 μm of tissue was discarded and then another 20 100 nm cross sections were collected per sample. These sections were mounted on bare 200 mesh or 300 mesh copper grids, which were then imaged by a Philips EM410 Transmission Electron Microscope with a NANOSPRT5 camera and AMT V701 software. Digital images of muscle fibers and NMJs were captured from sections at magnifications between 21,000x and 38,000x. In total, images of 28 young adult wild-type NMJs and 29 young adult Megf10 KO NMJs were taken. It was not possible to determine which of these images were of different NMJs or whether images were of the same NMJ at different depths, but imaging at two different depths within the tissue increases the likelihood that we sampled several different NMJs per mouse. For analysis of axon terminal synaptic vesicles and mitochondria, 37 wild-type and 21 Megf10 KO synaptic regions with the best delineation of these ultrastructural features were analyzed from these NMJs. A synaptic region is defined as a synaptic gutter and its apposing axon terminal. The muscle, axon terminal, and PSCs in each image were identified by morphology. Adobe Photoshop 2022 (version 23.2) was used to pseudocolor each of these cell types red, blue, and green, respectively.

Transmission electron micrographs were analyzed in ImageJ. PSC processes intruding in the synaptic cleft were identified as NMJs with PSC processes that extended at least 200 nm into the synaptic cleft. Loss of junctional folds was identified as NMJs with at least 20% of the postsynapse lacking junctional folds. Synaptic vesicle density and mitochondria density were calculated for motor axon terminals in which these structures were easily identifiable by dividing counts of synaptic vesicles and mitochondria by the area of the motor axon terminal which was measured using the polygon tool in ImageJ. Mitochondria density was calculated for muscle postsynaptic regions in which these structures were easily identifiable by dividing counts of mitochondria by the area of an arch-shaped region emanating 1 μm from the synaptic cleft into the muscle which was measured using the polygon tool in ImageJ.

Young adult (4–5 month old) female S100β-GFP; NG2-DsRed mice were sacrificed and the hindlimb muscles were immediately collected and dissociated in 2 mg/mL collagenase II (Worthington Chemicals, Lakewood, NJ) followed by mechanical trituration. A single cell suspension was created with a 40 μm filter, and then excess debris was removed by centrifugation in 4% BSA followed by centrifugation in 40% Optiprep solution (Sigma-Aldrich, St. Louis, MO) from which the interphase was collected. A BD FACS Melody Cell Sorter (BD Biosciences) was used to perform FACS. Each replicate was a single mouse, and approximately 5,000 PSCs and 30,000 other SCs were collected per replicate.

RNA was isolated from whole soleus muscle or from FACS-isolated PSCs and other SCs. RNA was isolated from whole muscle by Azenta. RNA was isolated from the PSCs and other SCs using the PicoPure RNA Isolation Kit (Thermo Fisher). All of the RNA was then reverse transcribed with iScript (BioRad, Hercules, CA). The cDNA from isolated PSCs and other SCs was preamplified with SsoAdvanced PreAmp Supermix (Bio-Rad, 1,725,160). Then, qPCR was performed on all samples with iTAQ SYBR Green Supermix (Bio-Rad, 1,725,121) using 300 nM primers for Megf10 (F: CAACTCCAGCCAACAGGAATG, R: GCAGCAGGTCATAATGGCAAG), Fgfbp1 (F: ACACTCACAGAAAGGTGTCCA, R: CTGAGAACGCCTGAGTAGCC), Pax7 (F: GCGAGAAGAAAGCCAAACAC, R: GTCGGGTTCTGATTCCACAT), Chrng (F: GCTCAGCTGCAAGTTGATCTC, R: CCTCCTGCTCCATCTCTGTC), Myh3 (F: CTTCACCTCTAGCCGGATGGT, R: AATTGTCAGGAGCCACGAAAAT), and Gapdh (F: CCCACTCTTCCACCTTCGATG, R: GTCCACCACCCTGTTGCTGTAG) on a CFX Connect Real Time PCR System (Bio-Rad). Expression values were normalized to Gapdh using the 2-ΔΔCT method.

Female 7-month-old WT and Megf10 KO mice were euthanized and the soleus muscle was immediately dissected and frozen in liquid nitrogen. RNA isolation and bulk RNA-seq were subsequently performed by Azenta with 4 replicates per genotype (i.e. WT and Megf10 KO) at a sequencing depth of 30 million reads per sample. Trimming of the RNA-seq data for quality and to remove adaptors was performed using Trimmomatic v.0.36 [19] and the Nextera TruSeq paired-end adapter (TruSeq3-PE-2.fa). Then, transcripts were indexed, aligned, and quantified by Salmon v.0.11.3 [20]. Examination of QC summary statistics was performed using FastQC v0.11.5 and MultiQC v1.0 [21]. After alignment, R statistical software v4.1.2 was used to generate lists of differentially expressed genes. Ensemble transcript IDs were converted to gene IDs by Biomart [22]. Salmon quantification files were imported using Tximport [23]. Differentially expressed genes were determined by DESeq2 [24]. Count reads of 5 or less were filtered out before running DESeq2. EnhancedVolcano was used to generate volcano plots [25]. Functional and pathway analysis was performed using Ingenuity Pathway Analysis (QIAGEN Inc, https://www.qiagenbio-informatics.com/products/ingenuity-pathway-analysis). The computational resources and services at the Center for Computation and Visualization, Brown University, supported this analysis.

Comparisons between two groups were made using an unpaired Student’s t-test or Welch’s unpaired Student’s t-test, depending on the results of an F-test of variance. When the groups in the experiment had more than two variables, comparisons were made with a two-way ANOVA and Tukey’s post-hoc analysis. GraphPad Prism (Version 9.5.1) was used for all statistical analyses and graph generation. A biological replicate was defined as a single mouse for all experiments except electron microscopy analysis where a biological replicate was defined as a single NMJ cross section. Biological replicate numbers are provided in the figure legends. Data are expressed as mean + standard deviation.