mRNA sequencing

Clinical study was approved by the Medical Ethics Committee of Shengjing Hospital of China Medical University and conducted based on the Declaration of Helsinki. All subjects provided written informed consent. mRNA sequencing was conducted using 22 CRC tissue samples and 18 adjacent tissue samples by Wuhan Yingzi Gene Technology Co., Ltd. Sample information was shown in supplementary Table 1. Data analysis of mRNA sequencing was as follows: the original sequencing data was obtained through data quality control. Clean data was compared to the reference genome of the corresponding species. Based on the comparison results, the library quality was evaluated, and the sample library data qualified for quality control was analyzed.

Bioinformatics analysis

GSE200427 chip (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE200427) containing 2 normal samples and 2 CRC samples and GSE196006 chip (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE196006) containing 21 normal samples and 21 CRC samples were download from NCBI. Differentially expressed genes (DEGs, |log2FC|> 1 and p < 0.01) were identified. GO and KEGG enrichment analysis was then carried out. In addition, list of genes related to E3 ligase was retrieved from GeneCards (https://www.genecards.org/) database using “E3 ubiquitin ligases” as a keyword. Ubiquitin ligase coding and related genes in gene class were obtained from UALCAN database (https://ualcan.path.uab.edu/cgi-bin/Kinase-summary2.pl).

Clinical samples detection

Twenty-nine pairs of fresh primary CRC and adjacent tissues, as well as 92 paraffin-embedded CRC tissues were collected. RNF112 levels were evaluated by immunohistochemistry using a scoring method (Zheng et al. 2022).

Immunohistochemistry

Sections were dewaxed and rehydrated. Afterwards, endogenous peroxidase was blocked with 3% H2O2 for 15 min. RNF112 (1:100, PA5-118,985, Thermo Fisher, USA) or Ki67 (1:100, AF0198, Affinity, Changzhou, China) antibodies were incubated overnight at 4°C, followed by secondary antibody (1:200, D110058, Sangon, Shanghai, China) at 37°C for 0.5 h. DAB was used to develop, and staining was acquired with a microscope.

Cell culture

GP2D and SW1116 cells were obtained from iCell (Shanghai, China). DLD1 and SW620 and NCM460 cells were obtained from Cellverse (Shanghai, China). DLD1, GP2D and NCM460 cells were cultured in 1640 (Solarbio, Beijing, China). SW1116 and SW620 cells were cultured in L-15 (Procell, Wuhan, China). Cells were placed at 37°C and 5% CO2.

Knockdown and overexpression

siRNAs targeting RNF112 were synthesized from JinTuoSi (Wuhan, China). shRNAs targeting RNF112 were cloned to pRNAH1.1 vector. In addition, KLF4 CDS, RNF112 CDS or NAA40 CDS were cloned to pcDNA3.1 vector. Cells were transfected using Liposome 3000 (Invitrogen, USA).

siRNAs targeting RNF112 were shown:

RNF112 siRNA-1, CCUGAGUGCCGGAAGAUAU;

RNF112 siRNA-2, CCUUCCUCCUCAACCAUUU;

RNF112 siRNA-3, GGUGAUGGGCAAGCAUUAU;

RNF112 siRNA-4, AGAGAUUGUCUGGCAGAUA;

RNF112 siRNA-5, CACCCAGAAAGAUGCCAUU.

shRNAs targeting RNF112 were shown:

RNF112 shRNA-1, GGGAAGATATGCAAGCAGAATTCAAGAGATTCTGCTTGC ATATCTTCCTTTTT;

RNF112 shRNA-2, GGGAAGTCCTTCCTCCTCAATTCAAGAGATTGAGGAGGA AGGACTTCCTTTTT.

Cell viability analysis

Cells (5 × 103/ well) were seeded in 96-well plates. Next, after 48 h and 72 h, CCK8 reagent (KeyGEN, Nanjing, China) was added. Finally, OD 450 was tested on a microplate reader (Biotek, USA).

Flow cytometry detection

For cell cycle, cells were treated with 500 µl PI/RNase A (KeyGEN) and incubated for 30 min. For apoptosis, cells were treated with 5 µl AnnexinV-FITC and 5 µl PI and incubated for 10 min. Finally, data was measured by a NovoCyte flow cytometer.

Caspase 3 and Caspase 9 activity

Caspase-3 (C1116, Beyotime, Shanghai, China) and Caspase-9 activity (C1158, Beyotime) was tested by the respective kits.

Xenotransplantation

Animal studies were approved by Medical Ethics Committee of Shengjing Hospital of China Medical University and in lines with the National Research Council’s Guide for the Care and Use of Laboratory Animals. After 1 week of adaptive feeding, BALB/c nude mice (4-week-old) were divided into 5 groups (vector, RNF112 OE, NC, RNF112 shRNA-1 and RNF112 shRNA-2). SW620 or DLD1 cells (2 × 106) were injected subcutaneously. Tumor size was measured every 5 days. After 4 weeks, mice were killed and tumor tissues were collected.

TUNEL staining

After deparaffinized and hydrated, sections were treated with 0.1% Triton X-100 (50 µl, Beyotime) for 8 min and 50 µl TUNEL solution for 1 h. Afterwards, sections were stained with DAPI for 5 min, and staining was acquired under a microscope.

Prediction of binding of KLF4 to RNF112 promoter

RNF112 promoter was retrieved through the UCSC Genome Browser Gateway database (https://genome-asia.ucsc.edu/cgi-bin/hgGateway?hgsid=730609074_3yH3.

QyIyhAexYB3spswXoIohivRN), and the promoter sequence was pasted into the JASPAR database (https://jaspar.elixir.no/). Binding sites of KLF4 on the RNF112 promoter were predicted.

Luciferase reporter assay

Luciferase reporter vector containing the promoter sequence of RNF112 was constructed and transferred into SW620 cells with KLF4 overexpression plasmid. pRL-TK was a control plasmid. Finally, luciferase activity was measured 48 h later.

Chromatin-immunoprecipitation (Ch-IP) assay

Cells were incubated with 1% formaldehyde for 1 h and 10X Glycine Solution. Cells precipitates were then resuspended in SDS lysis. After ultrasonic treatment, 1.8 ml Ch-IP dilution buffer was added to 0.2 ml supernatant. 20 µl supernatant was used as input, and the remain supernatant was added to 70 µl Protein A + G Agarose/Salmon Sperm DNA. After centrifugation, supernatant was added with 1 µg KLF4 antibody (11,880–1-AP, Proteintech) or IgG. Then the mixture was treated with 60 µl Protein A + G Agarose/Salmon Sperm DNA. Afterwards, DNA–protein complex was added with 5 M NaCl, and the purified DNA was used for PCR assay. PCR primers were as follows:

Ch-IP-1

F: 5’-CCTGCCTTGACAACCTTT-3

R: 5’-GATGGGACAATCAGTCTTCAC-3’

Ch-IP-2

F: 5’-GGTAATGGTGGCTCCTC-3’

R: 5’-CCTTCTCATCCCTCCTG-3’

Co-immunoprecipitation (Co-IP)

Cells were lysed and proteins were isolated. The antibody was immobilized, and IP was performed. In brief, IP lysate (200 µl) was added to the resin that solidified the antibody. After elution, the obtained samples were used for western blot.

Ubiquitination assay

For ubiquitination analysis, cells were treated with 10 µM MG132 for 8 h. Western blot was used to detect ubiquitination levels.

IP-LC/MS and Label-Free assays

RNF112 overexpression vector (with Flag tag) and its control vector (with Flag tag) were constructed and transfected into SW620 cells, respectively. After 48 h, IP-LC/MS analysis was performed on the vector-Flag and RNF112-Flag from anti-Flag by Novogene (Beijing, China). According to the files detected, the corresponding database was searched for protein identification. At the same time, mass tolerance distribution of polypeptide, protein and parent ion was analyzed to evaluate the quality of mass spectrometry data.

RNF112 overexpression vector or its control vector were transfected into SW620 cells, respectively. After 48 h, cells were employed for Label-Free. Label-Free was conducted by Qinglian Baiao Technology Co., Ltd. (Beijing, China) in accordance with a standard experimental procedure. Differentially expressed proteins (|log2FC|> 1 and p < 0.05) were identified. Proteins were then subjected to GO and KEGG enrichment analysis.

Immunofluorescence double staining

After blocking with 1% BSA, sections were incubated with Flag (1: 100, 66,008–4-Ig, Proteintech) and NAA40 (1: 100, 16,698–1-AP, Proteintech) antibodies at 4°C overnight, followed by respective secondary antibodies (1: 200, #4408, CST, USA or 1: 200, #4413, CST) for 1 h. Finally, after treating with DAPI, sections were pictured with a microscope.

Real-time PCR

Total RNA was extracted with TRIpure. Next, RNA was transcribed into cDNA by All-in-One First-Strand SuperMix (Magen, Guangzhou, China). Afterwards, real-time PCR was conducted with the SYBR Green kit (Solarbio). Relative mRNA levels were calculated with a 2−ΔΔCt method. Primers were shown as follows:

RNF112, F: 5’-GGACAGACGCCTACTCACG-3’;

RNF112, R: 5’-CTGCCTCACATACTCCTCGA-3’;

KLF4, F: 5’-CCAGAGGAGCCCAAGCCAAAG-3’;

KLF4, R: 5’-TCCACAGCCGTCCCAGTCA-3’;

β-actin F: 5’-GGCACCCAGCACAATGAA-3’;

β-actin R: 5’-TAGAAGCATTTGCGGTGG-3’.

Western blot

Total protein was extracted and quantified by BCA assay kit (Beyotime). 20 µg protein was loaded into each well of a 10% SDS-PAGE gel and transferred to PVDF membranes (Abcam, UK). Next, the blots were incubated with RNF112 (1:1000, PA5-118,985, Thermo Fisher), Cyclin E1 (1:1000, 11,554–1-AP, Proteintech), CyclinD1 (1:5000, 26,939–1-AP, Proteintech) and NAA40 (1:500, 16,698–1-AP, Proteintech) antibodies overnight at 4 °C. Thereafter, the blots were incubated with HRP-labeled goat anti-rabbit IgG (1:5000, A0208, Beyotime) or goat anti-mouse IgG (1:5000, A0216, Beyotime) at 37 °C for 45 min. Finally, the blots were treated with ECL reagent, and data were then analyzed by Gel-Pro-Analyzer software.

Statistical analysis

In this study, data are expressed as mean ± SD. Data between two groups were compared by student’s t-test. Data of multiple groups were compared by one-way or two-way ANOVA. Correlation between RNF112 expression and clinicopathological features was analyzed by Chi-square test. Additionally, correlation between RNF112 mRNA and KLF4 mRNA was evaluated by Pearson. p < 0.05 was considered statistically significant.