Agents

RPMI-1640, DMEM/F12, and Dulbecco’s modified Eagle medium (DMEM) were source from Gibco (Thermo Fisher Scientific, Waltham, MA). Fetal bovine serum (FBS) was obtained from VivaCell Biosciences (Shanghai, China). Inhibitors, including MG132 (#2619), bortezomib (#S1013), and cycloheximide (#7418), were purchased from Selleckchem (Houston, TX). N‐ethylmaleimide (#T3088) was purchased from TargetMol (Wellesley Hills, MA).

The following antibodies, including SENP3 (#5591), SIX1 (#16,960), SUMO2/3 (#4971), p-Rb (#8516), Rb (#9313), cyclin D1 (#55,506), E-cadherin (#8834), N-cadherin (#13,116), GAPDH (#5174), FLAG(DYKDDDK)-tag (#14,793), and HA-tag (#3724, #2367), were purchased from Cell Signaling Technology (Beverly, MA); secondary antibodies, goat anti-mouse IgG H and L (Alexa Fluor® 594) (ab150120), and goat anti-rabbit IgG H and L (Alexa Fluor® 488) (ab150077) were sourced from Abcam (Boston, MA).

Cell culture

The following human cell lines were all purchased from the American Type Culture Collection (Manassas, VA): embryonic kidney HEK293T cells, normal prostate cell lines RWPE-1 and WPMY-1, AR-positive PCa cell lines LNCaP, 22Rv1, and C4-2, and AR-negative PCa cell lines PC3 and DU145. The identities of the cell lines were confirmed using STR Authentication, and standard mycoplasma checks confirmed no contamination. As previously described [23, 24], cell lines were grown in an incubator maintained at 37 °C temperature and 5% CO2. In short, the 22Rv1, LNCaP, and C4-2 cell lines were incubated in RPMI-1640 medium supplemented with 10% FBS. HEK293T, RWPE-1, and WPMY-1 were incubated in DMEM supplemented with 10% FBS. DU145 and PC3 cells were incubated in DMEM/F12 medium supplemented with 10% FBS.

Plasmids and small interfering RNAs (siRNAs)/short hairpin RNAs (shRNAs) for transfection

FLAG-tagged full-length human SENP3 (Gene ID: 26,168) and inactive mutant SENP3-C532A were synthesized with pENTER by Kidanbio (Guangzhou, China). Full-length and point mutants human SIX1 with HA-tagged (Gene ID: 6495) were synthesized with pcDNA3.1( +) by IGEbio (Guangzhou, China). Two HA-tagged truncated mutants of SIX1 plasmid (pEnter) were purchased from VigeneBio (Shandong, China). As previously reported [25], a cocktail consisting of RPMI Opti-MEM (Gibco), Lipofectamine 3000 reagent (Invitrogen), and plasmids, added sequentially, were incubated for 15 min. The cocktail was then added to the cells in dishes or plates for 48 h for further verification and analysis.

For siRNA transfection, as previously reported [23], RPMI Opti-MEM and Lipofectamine RNAiMax (Invitrogen) were mixed with siRNAs targeting SENP3 or SIX1 and incubated for 15 min. The cocktail was then added to the cells in dishes or plates for 48 h for further verification and analysis. The sequences are as follows:

human si-SENP3-1: 5′- CCAGCATCCTCATCAGCAA -3′;

human si-SENP3-2: 5′- GCAGGACATGCCCAAACTT -3′.

human si-SIX1-1: 5′- CCAACTCTCTCCTCTGGAA -3′;

human si-SIX1-2: 5′- GCCAGGAGCTCAAACTATT-3′.

For lentivirus shRNA transfection, two pair of RNAs targeting human SENP3 were synthesized using pSH-U6-gRNA-CMV-SpCas9-P2A-puro by Vigene Biosciences (Shandong, China). After incubated with 5 μg/ml polybrene (#sc-134220, Santa Cruz) for 15 min, two independent lentiviruses were added to PCa cell culture plates at a multiplicity of infection (MOI) of ten. After transfection for 48 h, non-transfected cells would be eliminated through puromycin (#S7417, Selleck-chem) screening at a concentration of 2 μg/ml for 48 h. The shRNAs sequences of SENP3:

Sh-SENP3-1: 5′- CTATACAAGGGACCGGGTCC -3′.

Sh-SENP3-2: 5′- CCAGGCGGGAGCGTCTTCGT -3′.

Co-IP assay

As we previously reported [23], total protein was collected using lysis buffer (#9803, Cell Signaling Technology, CST). A co-IP assay was conducted to investigate protein–protein interactions using a Dynabeads™ Kit (#14311D, Invitrogen). According to the kit’s specifications, specific antibodies were coupled with 1.5 mg of dynabeads for 16–24 h. Next, the antibody–dynabeads mixture were incubated with cell lysates for 1–2 h. The antibody–dynabeads–protein complex was washed three times with PBS-Tween-20 and then mixed with 1× blue loading buffer (#7722, Cell Signaling Technology). The mixture was heated in a metal bath at 70 ℃ for 5 min. The targeted proteins in supernatant were then collected by centrifugation at 13,000 rpm for 3 min.

In experiments to detect SUMOylation levels, it was also necessary to add freshly prepared 20 mM N-ethylmaleimide (NEM) to the lysis buffer, which was crucial to prevent further deSUMOylation of proteins, thereby enhancing the detection efficiency of SUMO conjugates[26,27,28]. Beyond this, all other steps were in accordance with the specifications.

LC–MS/MS assay

For liquid chromatography tandem mass spectrometry (LC–MS/MS) analysis, we collected whole-cell lysates and performed Co-IP using the corresponding antibodies. We then proceeded with SDS–PAGE to separate the proteins, which were subsequently developed by silver staining (#P0017S, Beyotime). The gel was thoroughly rinsed with ddH2O and treated with a destaining reaction. The proteins were digested with trypsin into peptides, centrifugally concentrated, and dried. The peptides were resuspended in acetonitrile/formic acid, reconstituted in Nano-LC Solvent A (0.1% formic acid in water), and loaded onto a nanoViper C18 trap column for an Easy nLC 1200 separation system (ThermoFisher). After a 5-min desalting process with solvent A (water/acetonitrile/formic acid, 98/2/0.1%), a 60-min gradient elution was executed with solvent B (water/acetonitrile/formic acid, 2/98/0.1%) on an analytical column. The resulting peptides were analyzed using a ThermoFisher Q Exactive mass spectrometer with a Nano Flex source (ThermoFisher, USA). Data was acquired using an ion spray voltage of 1.9 kV and an interface heater temperature of 275 °C. The raw MS/MS data was processed with PEAKS Studio 8.5 for protein identification and quantification.

Western blotting

Western blotting was used to detect protein levels. Total proteins were extracted from PCa cells and stored at −80 °C. Protein samples were separated by SDS–PAGE and transferred to PVDF membranes. Subsequently, the samples were incubated with 5% defatted milk for 1 h and then with appropriate primary antibodies at 4 °C overnight. Secondary horseradish peroxidase (HRP)-linked antibodies were then incubated with the samples at 24 °C for 1 h. Finally, the proteins were detected using either ECL reagent (#sc-2048, Santa Cruz Biotechnology) or enhanced ECL reagent (#FD8030, FDbio Science, Hangzhou, China), and then developed using X-ray films.

Immunofluorescence assay

The immunofluorescence assay was used to investigate protein–protein interactions, as previously reported [29]. PCa cells were transfected with HA-SIX1 or FLAG-SENP3 plasmids for 48 h, fixed with 4% paraformaldehyde at room temperature for 15 min, and permeabilized with 0.5% Triton X-100 in PBS for 10 min. After blocking with 5% BSA at room temperature for 30 min and washing with PBS three times, the cells were incubated with primary antibodies at 4 °C overnight, followed by incubation with fluorescent secondary antibodies for 1 h. Finally, the cell nuclei were stained with DAPI (#ab104139, Abcam), and digital photographs were collected using a ZEISS confocal microscope (#LSM980, ZEISS).

RNA extraction and quantitative real-time PCR analysis

Total RNAs extracted from PCa cells were reverse transcribed into cDNA as previously reported [30]. In simple terms, after the cells were washed with cold PBS, TRIzol was added for lysis. The mixture was incubated for 5 min and then transferred to 1.5 mL EP tubes. After centrifugation, the supernatant was taken, mixed with chloroform, and centrifuged again to obtain the aqueous phase. This was mixed with isopropanol and allowed to stand for 10 min. After centrifugation, the supernatant was discarded, and the pellet was washed successively with 75% and 95% ethanol, dried, and dissolved in DEPC water. The RNA purity was tested, and the 260/280 ratio should be between 1.9 and 2.0. The RNA was stored short-term at −20 °C, long-term at −80 °C, or reverse transcribed into cDNA.

Subsequently, quantitative real-time PCR analysis was performed using a TB Green® Premix Ex Taq™ II kit (#RR820A, TakaRa) with an ABI StepOnePlus™ Real-Time PCR System. All tests were independently repeated in triplicate. The PCR primers were as follows [7, 16]:

Forward-human SENP3: 5′‐CAAAGTCTCCTCTGGACCCTG‐3′;

Reverse-human SENP3: 5′‐TGCTGCACACATTGCTGATGAG‐3′.

Forward-human SIX1: 5′-AAGGAGAAGTCGAGGGGTGT-3′.

Reverse-human SIX1: 5′-TGCTTGTTGGAGGAGGAGTT-3′.

Forward-human GAPDH: 5′‐GGTATCGTGGAAGGACTCATGAC‐3′.

Reverse-human GAPDH: 5′‐ATGCCAGTGAGCTTCCCGTTCAG‐3’.

Cell proliferation assay

Cell proliferation consisted of cell viability determination, EdU staining analysis (#C10310-1, Ribobio), and live cell assay. We performed the cell viability assay using the MTS kit (#G3581, Promega). The EdU staining analysis was conducted using a microscope (#BX53, OLYMPUS). For clonogenic assays, transfected PCa cells were re-plated in six-well plates and allowed to grow for at least 10 days. The cells were then stained with crystal violet (#C0121, Beyotime Biotechnology). All tests were repeated independently in triplicate. The live cell assay utilized an Incucyte® S3 Live Cell Analysis System (Sartorius, Goettingen, Germany). In short, a certain density of PCa cells (22Rv1: 1500; PC3: 1000) were plated per well in 96-well plates. After 1 day, the cells were transfected with shRNAs. Cell confluence values were measured every 6 h for 6 days and then used to construct proliferation curves.

Scratch and cell migration assay

Scratch assays were performed using 25 culture inserts, with three wells for self-insertion (#80,369, ibidi, Gräfelfing, Germany). After 48 h of siRNAs transfection, PCa cell lines in each treatment group were resuspended in new culture medium and seeded onto six-well plates with inserts. When cell confluence reached 90%, the inserts were removed, and 2 ml of the corresponding medium was added to each well. Scratch distances of PCa cells at 0, 12, and 72 h were observed and recorded.

Cell migration assay was performed using 24-well transwell chamber (#3422, Corning, New York, USA). As previously reported [25], 5 × 104-treated 22Rv1 or 8 × 103 PC3 were resuspended with 200 μl serum-free medium and plated into the upper side of the chamber; the lower side chamber was filled with 600 μl of the corresponding medium supplemented with 10% FBS. After incubation for an appropriate time, 4% paraformaldehyde was used to fix the cells on the underside for 15 min, and then the migrating cells adhering to the underside were stained with crystal violet for 15 min. Digital photographs were collected using a microscope (#BX53, OLYMPUS).

Immunohistochemistry assay

The expression of SENP3 in patients from the Affiliated Cancer Hospital & Institute of Guangzhou Medical University (Guangdong, China) was detected by immunohistochemistry. As we previously reported [23], the immobilized samples were incubated according to the specifications of the MaxVision™ HRP-Polymer kit (#KIT-5004, Maixin Biol, Fujian, China), then stained with DAB and counterstained with hematoxylin. Finally, the ImageJ software was used to analyze the digital images.

22Rv1 xenograft models

NOD-SCID mice were purchased from Charles River Laboratory (Beijing, China). As previously reported [23], the mice were randomly divided into three groups and housed in the Laboratory Animal Center of Guangzhou Medical University. Then, 2 × 106 cells with stable expression of control shRNA, SENP3 shRNA-1, or shRNA-2 were injected subcutaneously into each mouse. The weight and tumor size of the mice were measured at specified times after inoculation. On the 16th day after tumor formation, all mice were euthanized by cervical vertebrae dislocation following CO2 asphyxiation. The tumor weights were then measured.

Statistical analysis

One-way ANOVA or Student’s t-tests were used to analyze three or more independent datasets for statistical significance on GraphPad Prism 8 and SPSS 22.0. A P value of less than 0.05 (two-sided) was considered statistically significant.