Cell culture

MCF-7 and T47D breast cancer cells were purchased from the American Type Culture Collection (ATCC). MCF-7 cells were grown in DMEM medium (Gibco, USA) with 10% FBS (Hyclone, USA), while T47D cells were cultured in RPMI-1640 medium (Gibco, USA) plus 10% FBS (Hyclone, USA). Palbociclib-resistant MCF-7 and T47D cells have been established at our laboratory previously [35] and were cultured in DMEM or RPMI-1640 medium with 10%FBS plus 6 μM palbociclib.

SiRNAs and plasmids transfection

SiRNAs to CXCR4 were designed and synthesized by GenePhrama (China). The sequence of siCXCR4-1: sense (5′–3′) CCGACUUCAUCUUUGCCAATT, antisense (5′–3′) UUGGCAAAGAUGAAGUCGGTT; siCXCR4-2: sense (5′–3′) GGGACUAUGACUCCAUGAATT, antisense (5′–3′) UUCAUGGAGUCAUAGUCCCTT. For siRNA transfection, Cells were plated at a density of 30–40% in 6-well plates and cultured for 12 h. For transfection, 3.75 μl lipo3000 (L3000008, Invitrogen) and 5 μl siRNAs were mixed with 125 μl optimal medium (Gibco,USA) separately and incubated for 5 min, then were mixed together and incubated for another 20 min. The 250 μl mixture was adding to cultured cells with 1.75 ml fresh medium containing 10%FBS, then the medium was changed after 24 h. RT-qPCR and western blotting were performed as described below to verify whether CXCR4 was efficiently knocked down.

To obtain CXCR4 overexpression plasmids, the sequence of CXCR4 mRNA was cloned into a pCDH-puro-vector (pCDH-puro-CXCR4). For plasmids transfection, cells were planted at a density of 40%−50% into 6-well plates. The indicated plasmids (1 μg/well) were mixed with P3000(10 μl/well, Thermo Scientific, L3000008) in 125 μl optimal medium and incubated for 5 min before adding to another 125 μl optimal medium with Lipo3000 transfection reagent (3.75 μl/well, Thermo Scientific, L3000008). The mixture was then incubated for 20 min at room temperature before adding to the cultured cells. After 48 h, the cells were harvested for subsequent analysis.

Colony formation and MTT assay

For colony formation assay, cells were plated in 6-wells plate(1000/well) and cultured in medium with 10% FBS, and treated with palbociclib or AMD3100 for 2 weeks, then were fixed by 4% paraformaldehyde and stained with crystal violet for colony number count.

For MTT analysis, 5 mg/ml MTT solution (3580MG250, Biofrox) was prepared and added into the cells cultured in 96-well plates with a ratio of 1:10. After incubation at 37 °C for 4 h, the absorbance was measured at a wavelength of 490 nm by a microplate spectrophotometer.

RNA extraction and RT-qPCR

Cultured cells were washed twice by PBS buffer, then total RNA was extracted by RNA separation and purification kit (ES-RN001, YISHAN BIOTECHNOLOGY) according to the manufacturer’s instructions. RNA concentration was detected by NanoDrop Spectrophotometer (Thermo Scientific, USA). RNA was reversed transcribed to cDNA using PrimeScript RT Master Mix (RR036A, Takara) followed the description. Then the cDNA was subjected to qPCR analysis using TB Green Premix Ex Taq II (RR820A, Takara) in Real Time-PCR system (LC480, Roche). Primer sequences: CXCR4 Forward (5′–3′): ACTACACCGAGGAAATGGGCT; Reverse (5′–3′): CCCACAATGCCAGTTAAGAAGA), CXCL12 Forward (5′–3′):ATTCTCAACACTCCAAACTGTGC; Reverse: (5′–3′): ACTTTAGCTTCGGGTCAATGC, WNT5A Forward (5′–3′): ATTCTTGGTGGTCGCTAGGTA, Reverse (5′–3′): CGCCTTCTCCGATGTACTGC, CTNNB1 Forward (5′–3′): AGCTTCCAGACACGCTATCAT; Reverse (5′–3′): CGGTACAACGAGCTGTTTCTAC; WNT5B Forward (5′–3′): CATGGCCTACATAGGGGAGG, Reverse (5′–3′): CTGTGCTGCAATTCCACCG, WNT16 Forward (5′–3′): AGTATGGCATGTGGTTCAGCA; Reverse (5′–3′): GCGGCAGTCTACTGACATCAA, WNT8B Forward (5′–3′): CCGACACCTTTCGCTCCATC; Reverse (5′–3′): CAGCCCTAGCGTTTTGTTCTC, WNT10A Forward (5′–3′): AGATCGCCATCCACGAATGC; Reverse (5′–3′): ATCTTGTTGCGAGTCTCCAGG, WNT11 Forward (5′–3′): GACCTCAAGACCCGATACCTG; Reverse (5′–3′): TAGACGAGTTCCGAGTCCTTC, GAPDH Forward (5′–3′): CTGGGCTACACTGAGCACC; Reverse (5′–3′): AAGTGGTCGTTGAGGGCAATG.

Western blotting

Cells were plated in 6-well plate and with given treatment in advance. Then cultured cells were washed twice by cold PBS buffer before lysed in 70ul RIPA lysis buffer plus cocktail and phosphatase inhibistors (78,442, Thermo Scientific) on ice for 30 min. Supernatant of the lysates were isolated by centrifuging at maximum speed for 30 min and the concentration of total protein was measured by BCA kit (23,227, thermo scientific). Before immunoblotting analysis, the quantified supernatant was boiled with 4xloading buffer for 5 min at 98 °C. After SDS-PAGE electrophoresis for around 1 h, the protein was transferred onto a PVDF membrane and was closed in 5% BSA for 2 h, then incubated with primary antibodies overnight at 4 °C. The primary antibodies of CXCR4 (ab124824, Abcam), CXCL12 (17,402, proteintech), WNT5A (2392, CST), β-catenin (51,067, proteintech) were purchased and were diluted into 5%BSA at a ratio of 1:1000. Next day, HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (7076/7074, CST) were added and incubated for 1 h at room temperature, then signals were detected by enhanced chemiluminescence (34,095, Pierce) and were visualized by CCD camera.

Immunofluorescence

Cells were plated in confocal dishes(5 × 104/dish) and cultured in the medium plus 10%FBS for 12 h, then changed the medium with 10 μM AMD3100 in the absence of serum and cultured for 3 h, added 100 ng/ml CXCL12 and grown for another 24 h. These treated cells were washed 3 times by PBS buffer, and then were fixed by 4% paraformaldehyde for 20 min at room temperature, permeabilized in PBS containing 0.05% Triton X-100 for 3 min on ice, and closed in 5%BSA for 30 min at room temperature. Then cells were incubated overnight at 4 °C with primary antibodies against CXCR4 and β-catenin, which were diluted into 5%BSA at a ratio of 1:1000. Next day, Alexa Fluor secondary antibodies were added and incubated for 1 h at room temperature. Finally, DAPI was added and stained for 10 min before taking images by confocal microscopy (LSM800, Zeiss).

Immunohistochemistry

Paraffin-embedded tissue sections were deparaffinized before antigen retrieval by boiling in 0.01 M citrate buffer (pH 6.0) for 30 min. 3% hydrogen peroxide in PBS was added for 15 min to block endogenous catalase activity. Furthermore, 5% BSA in PBS was used to close nonspecific binding for 30-min incubation at room temperature. Tissues were then incubated with anti-CXCR4 (ab124824, Abcam) antibody at 4 °C overnight. Next day, tissues were incubated with HRP-conjugated secondary antibody and stained with DAB (GSK500710, Gene Tech) before taking images by microscopy (Nikon, Japan). The IHC staining scores were determined as we previously described.

Mammosphere formation assay

Cultured cells were isolated into signal cell dilution by 0.4% trypsin, and washed twice by PBS buffer to remove FBS absolutely. Then cells were plated in 24-wells ultra-low adhesion plate (1000/well) in the spheroid medium, which containing of BSA, B27, insulin, FGF and Penicillin–Streptomycin in DMEM/F12 medium. To avoid cell gathering, blow it with a pipette twice a day, and spheroids grown up around 1 week later. Microscopy (Nikon, Japan) were used to take images of spheroid and the formation rate was calculated for quantitative analysis.

Flow cytometry

ALDH activity was assayed by ALDEFLUOR kit (01700, Stem Cell Technologies), following the manufacturer’s instructions. In brief, spheroid cells were dissociated into single cells by 0.4% trypsin, washed twice with PBS, suspended in 500 μl ALDEFLUOR assay buffer, then 5 μl ALDH substrate was added to each tube. What’s more, 5 μl DEAB (diethylaminobenzaldehyde, a specific ALDH inhibitor) was added to preformed as a negative control. After an incubation at 37 °C for 45 min, cells were washed twice and re-suspended in ALDEFLUOR assay buffer, then flow cytometer (BD, USA) was used to analyze the proportion of ALDH positive cells.

Animal experiment

All the animal studies were approved by Sun Yat-sen University laboratory animal care and use committee. Four weeks old femal BABL/c nude mice, provided by Vital River Laboratory, were housed under a specific pathogen-free condition of 12 h light/12 h dark cycle in a temperature- and humidity-controlled cage and were fed ad libitum. palbociclib-resistant MCF-7 cells (1 × 107 per mouse) were inoculated to mammary fat pad of BABL/c nude mice after 17β-Estrogen pellets (0.72 mg, 60-day release, innovative research of America) were implanted subcutaneously for a week. For CDK4/6 inhibitors treatment groups, palbociclib (100 mg/kg) was given by gavage every day. And for AMD3100 treatment groups, AMD3100 (5 mg/kg) was given via intraperitoneal injection every 3 days. 6 weeks later, all mice were euthanized in a humane manner, all tumors were collected and the tumor volumes were calculated. Then the tumors were embedded by paraffin and subjected to IHC staining.

Statistics and reproducibility

Statistical analyses were performed using R (version 4.4.0) or excel software. Unless otherwise noted, results were expressed as means ± SD. The p values were calculated by Student’s t-test for two group and one-way ANOVAs for multiple groups comparison.