Reagents and antibodies

The following antibodies were used: anti-GAPDH antibody (60004-1-lg) were purchased from Proteintech (IL, USA); anti-CCNB1IP1 (ab71997) and anti-Histone H3 (ab194684) antibodies were purchased from Abcam (Cambridge, UK); anti-AdipoR1 (sc-518030), anti-GFP (sc-9996) and anti-MYC (sc-40) antibodies were purchased from Santa Cruz Biotechnology (Texas, USA); anti-FLAG antibody (SLCF9337) was purchased from Sigma (St. Louis, USA); anti-ESR1 (4267 S), anti-Ubiquitin (14049 S), anti-cyclin B1 (12231 S) and anti-CDC2 (77055 S) antibodies were purchased from Cell Signaling Technology (CST, United States). Secondary antibodies goat anti rabbit IgG- (H + L) HRP conjugate (cat. no. 170–6515) and goat anti-mouse IgG-(H + L) HRP conjugate (cat. no. 170–6516) were obtained from Bio-Rad Laboratories (Mississauga, Ontario, Canada). CoraLite 594–conjugated goat Anti-Rabbit IgG (H + L) (Cat No. SA00013-4) was purchased from Proteintech (Rose-mont, IL). Cycloheximide(CHX), chloroquine(CQ), carbobenzoxy-Leu-Leucinal (MG132) were purchased from MedChemExpress (MCE, USA).

Cell lines and cell culture

Human HCC cell lines MHCC-97 H, HepG2, and human embryonic kidney cell 293T were obtained from the Chinese Academy of Sciences cell bank (Beijing, China) and confirmed by short tandem repeat (STR). All cells were routinely cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, United States) containing 10% fetal bovine serum (Gibco, United States) and 1% penicillin/streptomycin (cat. no. 10378016, Life Technologies) at 37℃ in a humidified atmosphere of 5% CO2.

RNAseq for AdipoR1 knockdown and control cell

Total RNA was extracted from AdipoR1 knockdown and control MHCC-97 H cells using a TRIzol reagent. Samples were transferred to Novogene (Novogene, Beijing) for RNA isolation, quality control, library preparation, and sequencing.

Irradiation

An X-ray generator (X-RAD 320 ix, Precision X-ray Inc, North Branford, CT, United States) was utilized to deliver radiation at a dose rate of 3.0 Gy/min.

Lentiviral production

The lentiviral short hairpin RNA (shRNA) vector targeting AdipoR1 (pLKO. 1-shAdipoR1) was constructed according to the Oxidative Medicine and Cellular Longevityprotocol of pLKO. 1-blasticidin vector (Addgene, Cambridge, MA, USA). The forward oligo and reverse oligo were annealed and inserted into the pLKO. 1-blasticidin vector. Lentiviruses were produced in 293T cells after cotransfection of pLKO. 1-shAdipoR1 or pLKO. 1-shScramble, packing plasmid psPAX2, and envelope plasmid pMD2G. The virus-containing supernatant was collected 48 h after transfection, filtered and infected with target cells in the presence of 10 µg/ mL polyene (Sigma-Aldrich, H9268), followed by drug selection with 7 µg/ mL insecticide for one week. AdipoR1 shRNA sequence: the forward oligo: CCGGCGTCTATTGTCATTCAGAGAACTCGAGTTCTCTGAATGACAATAGACGTTTTTG and the reverse oligo: AATTCAAAAACGTCTATTGTCATTCAGAGAACTCGAGTTCT CTGAATGACAATAGACG.

Plasmid constructions and transfection

Human ESR1、cyclin B1 and CCNB1IP1 were cloned into the indicated vectors, including pcDNA3. 1-FLAG. Human cyclin B1 was cloned into the pcDNA3. 1-MYC. pEGFP-AdipoR1 plasmid was purchased from GenePharma (Shanghai, China). Once the sequencing is complete, the plasmid was extracted by an endotoxin-free plasmid purification kit (Qiagen Inc, Chatsworth, CA) and transfected into cells for verification.

Transfection of siRNA

When the cells reached approximately 30–50% confluence, they were transfected with siRNA using Lipofectamine 2000 (Invitrogen). For each transfection, 200 nmol of siRNA was added per 100 mm plate (final concentration:40 nM). Serum was added 4–6 h after transfection, and the medium was changed completely on the second day. The expression of this protein was detected by Western blot at 48 h after transfection. The sequences were listed as follows: siRNA for ESR1, CTACAGGCCAAATTCAGATAA.

Cell cycle analysis

The cell cycle was performed using propidium iodide (PI) staining and analyzed using flow cytometry. The cells were treated with ionizing radiation. After 48 h, cells were collected by trypsinization, washed with PBS, and fixed in 75% ethanol at 4℃ for at least 24 h. Cells were washed twice in PBS, and nuclear DNA was stained with 250 µl propidium iodide (50 µg/ml; SolarBio) in the presence of RNase A (1 µl, 10 mg/ml; SolarBio) in PBS for at least 15 min and then subjected to flowcytometric analysis (ACEA NovoCyte 2040R, USA), collecting 2 × 104 cells each time.

Western blot

Total protein from MHCC-97 H, HepG2 and HEK-293T were extracted on ice using RIPA Lysis Buffer (Beyotime) supplemented with a protease and phosphatase inhibitor cocktail (Roche, Basel, Switzerland). Extracted proteins were separated by sodium dodecyl (SDS)- PAGE and transferred to a PVDF membrane. After completion of the transfer, membranes were blocked with 5% nonfat milk in TBS/0. 1% Tween 20 for 120 min. Incubation with the primary antibody was conducted overnight at 4℃. Incubation with a peroxidase-conjugated anti-mouse or anti-rabbit secondary antibody (1:10000) was performed for 120 min at room temperature. Finally, chemiluminescent analysis was performed.

Immunoprecipitation assay

Cells were harvested 48 h after transient transfection and lysed in 1%NP-40 lysis buffer [137mM sodium chloride, 10mM sodium fluoride, 50mM TrIS-HCl (pH7.6), 1mM EDTA, 0.1 mm Na3VO4, 10% glycerol, 1%NP-40 and 1mM PMSF]. Whole cell lysates (WCL) were incubated with the specified antibodies overnight at 4 °C with constant rotation. On the second day, protein G plus -agarose was added and rotated at 4℃ for 2 h. The immune complexes were washed with IP washing buffer (China SGI) for 5 times, separated by SDS-PAGE, and analyzed by Western blot.

Ubiquitination assays

HA-tagged ubiquitin (UB), FLAG-tagged CCNB1IP1 and MYC-tagged cyclin B1 were simultaneously co-transfected into cells and treated with MG132(10µM) 4 h before cell harvest. The lysates were subjected to immunoprecipitation with FLAG antibodies overnight at 4 °C. Ubiquitinated proteins were determined by immunoblotting with anti-MYC antibodies (Santa Cruz, United States).

Luciferase reporter assays

Double luciferase–reporter gene determination was conducted to determine whether CCNB1IP1 the downstream target gene of ESR1. The CCNB1IP1 promoter fragments were inserted into the pGL3-Basic vector to generate pGL3-CCNB1IP1. pGL3-CCNB1IP1 promoter was cotransfected into cells with ESR1 overexpression vector or control vector by Lipofectamine 2000. After transfection for 48 h, luciferase activity was determined on a Centro LB 960 Luminometer (Berthold Technologies, Germany) and the activity of renilla luciferase was used as a standardized control.

Quantitative real-time PCR

Total RNA was extracted from cells with TRIzol solution (TaKaRa, Dalian, China). After the total RNA concentration was determined, the mRNA was reversely transcribed into cDNA using a reverse transcription kit (Takara Bio, Japan). qRT-PCR was carried out on a QuantStudio real-time PCR instrument (Thermo Fisher Scientific, USA) using SYBR Premix Ex Taq II (TaKaRa). The amplification conditions were 95 °C for 30 s, then 40 cycles at 95 °C for 5 s and 60 °C for 34 s. The mRNA levels were normalized to GAPDH. The following primers were used: the relative expression levels of genes were calculated using control GAPDH mRNA and the 2–ΔΔCt method. The following primers were used: GAPDH forward CCATGGGTGGAATCATATTGGA and reverse TCAACGGATTTGGTCGTATTGG; ESR1 forward GCTTACTGACCAACCTGGCAGA and reverse GGATCTCTAGCCAGGCACATTC; AdipoR1 forward CTCATCTACCTCTCCATCGT and reverse GAACACTCCTGCTCTTGTCT; cyclin B1 forward CTGCTGGGTGTAGGTCCTTG and reverse TGCCATGTTGATCTTCGCC; CCNB1IP1 forward CTCGGCCTCCCAAGTAGCT and reverse GTCTTCAGAACCTGATTGGCTAATGAGT.

Immunofluorescence assays

Cells were seeded on 24-well glass coverslips, the glass coverslips with cells were fixed with 4% paraformaldehyde for 20 min, and then subjected to 0.1% TritonX-100 treatment for 15 min. After blocking the cells with 10% donkey serum for 1 h, the cells were treated with the appropriate primary antibodies overnight. The next day, cells were incubated with the corresponding secondary fluorescent antibodies for 1 h and then incubated with DAPI buffer at 37 °C for 10 min.

CCK-8 assay and colony formation

Cells were seeded in 96-well plates (2 × 103 cells/well), irradiated with different doses of 0, 2, 4, 6 and 8 Gy for 96 h, and CCK-8 (CCK-8, Toshi Laboratory, Japan) was added to each well. Cells were incubated for 2 h. Absorbance was measured using a microplate reader at a wavelength of 450 nm. The proliferation rate of the cells was calculated by the following formula: cell viability=(OD experimental group − OD blank)/(OD control group − OD blank)× 100%. For colony formation assays, hepatoma cells were plated in 6-well plates and cultured in DMEM (Invitrogen) containing 10% fetal bovine serum (Gibco) at 37 °C and 5% carbon dioxide. After 24 h, cells were irradiated with different doses of 0, 2, 4, 6and 8 Gy, respectively. Cells were cultured for 14 days, then fixed with 4% paraformaldehyde (Solarbio, Beijing, China) for 30 min and stained with crystal violet staining (Solarbio, Beijing, China) for 15 min.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8 software (San Diego, CA, USA). Differences between the two groups were evaluated with Student’s t test (two-tailed). A multivariate analysis of variance was performed to assess the data obtained from two or more groups. The survival curve was generated with Kaplan–Meier method. Experimental results are presented mean ± SD. Data was considered as statistically significant when the p value was less than 0.05.