Animals

Male wild-type (WT) C57BL/6 J mice (6–8 weeks old, 19–25 g weight) and TXNIP knockout (KO) mice (6–8 weeks old, 19–25 g weight) on a C57BL/6 J background were obtained from Charles River Laboratories (Zhejiang, China, licence number: SCXK (Zhe)2019–0001). All animal experimental protocols were approved by the Animal Care and Use Committee of Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine and adhered to the Association for Research in Vision and Ophthalmology Statement on the Use of Animals in Ophthalmic and Vision Research. Mice were fed ad libitum, and their environment was maintained at approximately 21 °C on an alternating cycle of 12 h of light and 12 h of darkness. A total of 600 mice were used in this study.

Surgical induction of chronic ocular hypertension in mice

COH was induced in the right eyes of mice based on the protocol described in our previous study (Chen et al. 2021). Briefly, the mice were anesthetized by intraperitoneal administration of 80 mg/kg ketamine hydrochloride and 16 mg/kg xylazine (Sigma-Aldrich, St. Louis, MO, USA). A drop of 0.5% proparacaine hydrochloride (Bausch & Lomb, Tampa, FL, USA) was used for topical anesthesia of the ocular surface. A HyStem Cell Culture Scaffold Kit (HCCS; Sigma-Aldrich) was premixed and then immediately injected (3 µL) into the anterior chamber using a 31G needle (Hamilton Bonaduz AG, Switzerland) in the operation group. The same operative procedure was performed in the control group (Sham group), except that an equivalent volume of phosphate-buffered saline (PBS) instead of crosslinking hydrogel was injected into the anterior chamber of the right eye of each mouse.

The measurement of intraocular pressure (IOP)

The mice were given rapid general anesthesia by isoflurane (2%−4%, Sigma-Aldrich) inhalation, and the IOP was measured using a hand-held rebound tonometer (I-care Tonolab, Helsinki, Finland). The time of the IOP measurement was set between 10 a.m. and 2 p.m. IOP was measured immediately before the surgery, one day postoperatively and each week postoperatively until the end of the planned experimental period (at the fourth week after COH induction).

Animal grouping and drug administration

The mice were divided into groups according to a randomization procedure (http://www.randomizer.org/): the control, COH (WT mice or TXNIP KO mice) + PBS, COH (WT mice) + MCC950 (Selleck Chemicals, Houston, TX, USA). Intravitreal injections of 1 µL of MCC950 (10 mM) were performed three days prior to COH induction and weekly after surgery until the end point of the experimental sampling period (at the fourth week after COH induction). The first injection timepoint was three days before surgery, and the injections were repeated once weekly after surgery. Normal saline was used as a vehicle control. Intravitreal injections were performed using a 32G needle (Hamilton Bonaduz AG).

Primary retinal microglial cell cultures

Primary retinal microglial cell cultures were obtained from WT or TXNIP KO C57BL/6 J mice. Briefly, a cell suspension of dissociated retinas from one-day-old mice was plated in T75 flasks (with the cells from 24 retinas in each flask) and maintained in DMEM/F-12 medium (Gibco, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; EpiZyme, Shanghai, China) at 37 °C in a humidified incubator with 5% CO2. The cultures were shaken for seven hours at 110 rpm and 37 °C after 14 days. The microglia were collected from the cell supernatant, and then the collected microglia were resuspended and plated at a density of 3 × 106 cells/well in 10-cm2 cell culture dishes and cultured at 37 °C in a humidified atmosphere of 5% CO2. The purity of the isolated microglia was assessed using immunocytochemistry with an anti-IBA-1 antibody.

Cultures grouping and treatment

Isolated retinal microglia cultures were divided randomly into different groups as follows and compared within separate subsets respectively as designed for different targets of observation: microglia (WT) + PBS, microglia (WT) + recombinant mouse IL-17A (rmIL-17A; 100 ng/mL; R&D, Emeryville, CA, USA), microglia (TXNIP KO) + rmIL-17A (100 ng/mL) cultured under normal pressure at 37 °C in a humidified atmosphere of 5% CO2; microglia (WT) + PBS, microglia (WT) + rmIL-17A (100 ng/mL), microglia (WT) + IL-17A neutralizing antibody (IL-17A Nab; 50 ng/mL; R&D), microglia (TXNIP KO) + rmIL-17A (100 ng/mL), microglia (TXNIP KO) + LY294002 (25μM; Beyotime, Shanghai, China),cultured under high pressure at 37 °C in a pressurized cell culture system (Flexcell FX-5000, Flexcell International Corporation, Burlington, NC, USA).

Pressurized cell culture

Isolated retinal microglia were resuspended in mixed pressurized culture medium based on the protocol described in our previous study (Chen et al. 2023). Briefly, the mixed cell suspension was added to a BioPress compression culture plate (Flexcell International Corporation) at a density of 250 μL/well and cultured at 37 °C in a humidified atmosphere of 5% CO2 overnight. Pressurized cell culture was performed using a Flexcell FX-5000 compression system. The pressure of the compression system was set to 37.5 mmHg (5 kPa) at a frequency of 0.1 Hz, and the maximum duration of high-pressure culture was set to 8 h.

Western blotting analysis

Retinas or cells were lysed in radioimmunoprecipitation assay buffer (RIPA; Sigma-Aldrich) supplemented with a protease inhibitor cocktail (Sigma-Aldrich) at a 100:1 ratio. The samples were centrifuged, and the protein concentrations in the supernatant were quantified. SDS polyacrylamide gel electrophoresis was used to separate the proteins of different molecular weights in samples (containing equal amounts of protein), and the target proteins were then electrotransferred to polyvinylidene fluoride membranes. The membranes were blocked with rapid blocking solution at room temperature for 10 min and incubated with the corresponding primary antibodies of rabbit anti-actin (ab179467,1:5000; Abcam, Cambridge, UK), rabbit anti-TNF-α (ab215188, 1:1000; Abcam), rabbit anti-IL-1β (ab234437, 1:1000; Abcam), rabbit anti-IBA-1 (ab178846, 1:1000; Abcam), rabbit anti-IL-17A (ab79056, 1:1000; Abcam), rabbit anti-CD68 (ab303565, 1:1000; Abcam), rabbit anti-CD206 (ab64693, 1:1000; Abcam), rabbit anti-inducible nitric oxide synthase (iNOS; ab178945, 1:1000; Abcam), rabbit anti-arginase 1 (ARG1; ab233548, 1:1000; Abcam), rabbit anti-CD86 (ab112490, 1:1000; Abcam), rabbit anti-glial fibrillary acidic protein (ab7260, GFAP; 1:1000; Abcam), rabbit anti-glutamine synthetase (ab73593, GS; 1:1000; Abcam), rabbit anti-Brn3a (ab245230, 1:1000; Abcam), rabbit anti-TXNIP (14715S, 1:1000; Cell Signaling Technology, Boston, MA, USA), rabbit anti-p38(8690, 1:1000; Cell Signaling Technology), rabbit anti-p-p38 (4511, 1:1000; Cell Signaling Technology), rabbit anti-extracellular signal-regulated kinase 1/2 (ERK1/2; 8544, 1:1000; Cell Signaling Technology), rabbit anti-p-ERK1/2 (4370, 1:1000; Cell Signaling Technology), rabbit anti-Akt ( AA326, 1:1000; Beyotime), rabbit anti-p-Akt-ser473 (AA329, 1:1000; Beyotime), rabbit anti-p-Akt-thr308 (AA331, 1:1000; Beyotime), rabbit anti-PI3 Kinase p85 (4257 T, 1:1000; Cell Signaling Technology), rabbit anti-p-PI3 Kinase p85/p55 (4228 T, 1:1000; Cell Signaling Technology), rabbit anti-AMPKα (5831S, 1:1000; Cell Signaling Technology) or rabbit anti-p-AMPKα(50081S, 1:1000; Cell Signaling Technology) at 4 °C overnight. Then, the membranes were incubated with appropriate horseradish peroxidase-conjugated goat anti-rabbit (ab97051, 1:1000; Abcam) secondary antibodies at room temperature for 1 h. Protein bands on the membranes were visualized with an ImageQuant LAS 4000 Mini system (GE Healthcare Bio Sciences, Piscataway, NJ, USA) and quantitatively analyzed with the application of ImageJ software (version 2.1.0; Media Cybernetics, Silver Springs, MD, USA).

Real-time RT-PCR analysis

Total RNA was extracted from samples using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol. A NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA) instrument was used to determine the concentration and purity of the RNA. RNA was reverse transcribed into cDNA using a PrimeScript RT Master Mix kit (Takara, Tokyo, Japan). Quantitative RT-PCR was performed on each RNA sample in a volume of 10 μL using a TB Green Premix Ex Taq kit (Takara) on a 7500 Real-Time PCR system (Applied Biosystems, Waltham, MA, USA). Relative gene expression was quantified using the 2−ΔΔCt method, and β-actin was used as an internal reference gene. Six samples were used for each analysis, and the experiment was repeated three times. The primers designed for use in this study were as follows:

β-actin: forward, 5′-GCAGATGTGGATCAG CAAGC-3′ and reverse, 5′-GCAGCTCAGTAACAG TCCGC′;

IL-17A: forward, 5′-CACCGCAATGAA GACCCTGA-3′ and reverse, 5′-TTCCCTCCGCATTGA CACAG-3′;

IL-1β: forward, 5′-TGCCACCTTTT GACAGTGATG-3′ and reverse, 5′-AAGGTCCACGGGAAAGACAC-3′;

Arg-1: forward, 5′-CATATCTGCCAAAGACATCGTG-3′ and reverse, 5′-GACATCAAAGCTCAGGTGAATC-3′;

iNOS: forward, 5′- ACTCAGCCAAGCCCTCACCTAC-3′ and reverse, 5′-TCCAATCTCTGCCTATCCGTCTCG-3′;

CD206: forward, 5′-CCTATGAAAATTGGGCTTACGG.

−3′ and reverse, 5′-CTGACAAATCCAGTTGTTGAGG-3′;

CD68: forward, 5′-GAAATGTCACAGTTCACACCAG-3′ and reverse, 5′- GGATCTTGGACTAGTAGCAGTG-3′;

CD86: forward, 5′- ACGGAGTCAATGAAGATTTCCT-3′ and reverse, 5′- GATTCGGCTTCTTGTGACATAC-3′;

IBA-1: forward, 5′- ATTATGTCCTTGAAGCGAATGC-3′ and reverse, 5′- TCTCAAGATGGCAGATCTCTTG-3′; and.

TNF-α: forward, 5′- ATGTCTCAGCCTCTTCTCATTC-3′ and reverse, 5′- GCTTGTCACTCGAATTTTGAGA-3′.

TXNIP: forward, 5′-GACGATGTGGACGACTCTCAAGAC-3′and reverse, 5′-GTTGTTGTT AAGGACGCACGGATC-3′;

GFAP: forward, 5′-GAGAACAACCTGGCTGCGTATAGAC-3′and reverse, 5′- CCTCCTCCAGCGATTCAACCTTTC-3′;

GS: forward, 5′-TCCACGAAACCTCCAACATCAACG-3′and reverse, 5′- GTCTTCAAAGTAGCCCTTCTTCTCCTG −3′;

Brn3a: forward, 5′-ACGCTCTCGCACAACAACATGATC-3′and reverse, 5′- GCTCCGGCTTGTTCATTTTCTCAC-3′;

Flash visual-evoked potential examination

Flash visual-evoked potential (F-VEP) examination was performed according to the protocol described in our previous study (Chen et al. 2023). Briefly, the recording and reference electrodes were placed under the scalp at the occipital tuberosity and under the skin of the nose, respectively, in the anesthetized mice. The ground electrode was placed at the mastoid process, and then the eyes were adapted to the dark for 15 min. The contralateral eye was covered by an opaque black blindfold, and F-VEP (UTAS-E3000LKC, Multifocal Visual Diagnostic Test System, LKC Technologies, Gaithersburg, MD, USA) detection of the tested eye was started with flashing light stimuli at an intensity of 3.12 cd s−1 m−2. The high and low frequencies were 300 Hz and 0.1 Hz, respectively. The F-VEP inspections were carried out before the operation and again 4 weeks postoperatively, with at least three consecutive measurements being performed each time.

Immunofluorescence analysis of retinal whole mounts

The right eyes were enucleated from mice and further immersed in 4% PFA at 4 °C for 1 h. The eyecups were prepared, and the whole retinas were isolated and permeated with cold 0.25% Triton X-100 (Sigma-Aldrich) for 30 min and blocked in 5% BSA (Sigma-Aldrich) at room temperature for 1 h. The retinal whole mounts were incubated with the primary antibody rabbit anti-IBA-1 (ab178846, 1:500; Abcam), or rabbit anti-Brn3a (ab245230, 1:100; Abcam) at 4 ℃ overnight, followed by incubation for 1 h with fluorescence-conjugated secondary antibody (A31572, 1:500; Thermo Fisher Scientific) at room temperature. The retinas were cut into the shape of a four-leaf clover and mounted with fluorescence mounting medium (Dako, Carpinteria, CA, USA). Fluorescence images were obtained using a confocal laser-scanning microscope (LSM 510 META; Zeiss, Jena, Germany).

Immunofluorescence analysis of retinal cryosections

The right eyes were enucleated from euthanized mice and immersed in 4% PFA at 4 °C overnight. The eyecups were prepared and graded sucrose solutions were used for tissue dehydration. Then, the eyecups and optic nerves were embedded in an embedding agent (optimum cutting temperature compound, OCT; Sakura Finetek, Torrance, CA, USA) and frozen. A Leica microtome (CM1950, Wetzlar, Germany) was used to make ten-micrometer-thick tissue cryosections. The slices were permeated with cold 0.25% Triton X-100 (Sigma-Aldrich) for 30 min and blocked in 5% BSA (Sigma-Aldrich) at room temperature for 1 h. The retinal slices were respectively incubated with the primary antibodies of rabbit anti-GFAP (ab207165, 1:500; Abcam), mouse anti-TXNIP (ab210826, 1:500; Abcam), rabbit anti-GS (ab73593, 1:500; Abcam), or rabbit anti-IBA-1(ab283346, 1:500; Abcam) combined with mouse anti-CD68 (ab283654, 1:50; Abcam), and the optic nerve slices were incubated with a primary antibody of neurofilament heavy polypeptide (NEFH; ab207176, 1:100; Abcam) at 4 °C overnight, followed by incubation for 1 h with fluorescence-conjugated secondary antibodies corresponding to the species of the primary antibodies (A31572, A11055 or ab150165, 1:500; Thermo Fisher Scientific) at room temperature. After washed thoroughly, the sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime) for nuclear staining and mounted with fluorescence mounting medium (Dako). The fluorescence images were obtained using a confocal laser-scanning microscope (LSM 510 META; Zeiss).

Immunofluorescence analysis for primary retinal microglia

Primary retinal microglial cells were plated in 24-well plates with pretreated coverslips at cell density of about 1 × 105/well. The cells were washed using PBS for 3 times and immersed in 4% PFA for 15 min at room temperature. Then the microglia were permeated with cold 0.25% Triton X-100 (Sigma-Aldrich) for 30 min and blocked in 5% BSA (Sigma-Aldrich) at room temperature for 1 h. The retinal microglia were respectively incubated with the primary antibodies of rabbit anti-IBA-1 (ab178846, 1:500; Abcam) combined with mouse anti-iNOS (ab210823, 1:500; Abcam), or rabbit anti-IBA-1 (ab178846, 1:500; Abcam) combined with mouse anti-Arg-1(ab239731, 1:1000; Abcam) at 4 °C overnight, followed by incubation for 1 h with fluorescence-conjugated secondary antibodies corresponding to the species of the primary antibodies (A31572, A11055 or ab150165, 1:500; Thermo Fisher Scientific) at room temperature. After washed thoroughly, the microglia were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for nuclear staining and the coverslips mounted with fluorescence mounting medium (Dako). The fluorescence images were obtained using a confocal laser-scanning microscope (LSM 510 META; Zeiss).

Immunofluorescence quantification

For retinal whole mounts, the method for quantification was as follows. The RGCs and microglia located within 1/6, 3/6 and 5/6 of the retinal radius, with the optic papilla as the center point, were counted in each quadrant (as defined by anatomical orientation). The average RGC and microglial counts in the same size of area in different quadrants were calculated. Three images were acquired per retinal radius, for a total of 36 images per retinal whole mount. Images of retinal cryosection slices were obtained with the same exposure time and intensity. For image quantification, three randomly selected nonoverlapping subranges of 0.10 mm2 within a cryosection were examined; a total of 12 values for each staining target were obtained from one eye of each mouse, and these values were averaged for the individual mouse. Immunofluorescence quantification was performed according to a previous study (Reboussin et al. 2022). Image analyses were performed using ImageJ software (version 2.1.0; Media Cybernetics). The specific method was as follows: the images were converted into grayscale and the raw integrated density was quantified to obtain the sum of the pixel values.

RNA isolation and library preparation

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. A NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) was used to measure the purity and quantity of the total RNA. An Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to assess the RNA integrity. Libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions.

RNA sequencing and differentially expressed genes analysis

The libraries were sequenced on an Illumina HiSeq X Ten platform, and 150 bp paired-end reads were generated. Approximately 7.8 G of raw reads for each sample were generated. Raw data (raw reads) in fastq format were first processed using Trimmomatic, and low-quality reads were removed to obtain clean reads. Approximately 7.2 G of clean reads for each sample were retained for subsequent analyses. The clean reads were mapped to the mouse genome using HISAT2. The fragments per kilobase of exon per million mapped fragments (FPKM) value of each gene was calculated using Cufflinks, and the read counts for each gene were obtained using HTSeq-count. Differential expression analysis was performed using the DESeq (2012) R package. A P value < 0.05 and a fold-change > 2 or < 0.5 were set as the thresholds for significantly differential expression. Hierarchical cluster analysis of differentially expressed genes (DEGs) was performed to show the expression patterns of genes in different groups and samples.

Gene overexpression with a DNA-lipid complex

Primary retinal microglia were plated in 12-well plates at a cell density of approximately 3 × 105/ well. When cells reached 80% confluence, a DNA-lipid complex targeting TXNIP and a negative control complex (BioeGene, Shanghai, China) were transiently transfected into microglia using Lipofextamine 3000 plasmid transfection reagent (Invitrogen) according to the manufacturer’s protocol.

Statistical analysis

The results were presented as mean ± standard deviation (SD). Statistical analysis was performed using SPSS software (version 22.0; IBM Corporation, Armonk, NY, USA). The normality of the data distribution was tested using the Shapiro–Wilk test. Comparisons of experimental data were performed using a two-tailed independent-samples t test between two groups, or with one-way ANOVA followed by the Least Significant Difference test to determine differences between means in multiple sets of experiments. P < 0.05 indicated that a difference was statistically significant.