Cell culture and transfection

SIRT6high (T24, UMUC-3, BIU-87) and SIRT6low (5637, HT-1376, 253J) BLCA cells were obtained from either the American Type Culture Collection (ATCC). The identification of the cell lines was verified by short tandem repeat (STR) genotyping. The cell lines were cultivated in conventional RPMI 1640 (T24, UMUC-3, HT-1376) or DMEM (BIU87, 5637, 253J, 293 T) with the addition of 10% fetal bovine serum (FBS).

Quantitative real-time PCR

TRIzol solution (Invitrogen, Carlsbad, CA, USA) was utilized to get total RNA from cells or tissues. Reverse transcription (RT) was conducted with HiScript Q RT SuperMix for qPCR (Vazyme, Jiangsu, China). RT-PCR was performed in triplicate reactions via an Applied Biosystems 7900HT sequence detection system and a SYBR Green PCR Kit (Vazyme, Jiangsu, China). The following is a list of primers that were utilized (5'- > 3'): SIRT6: CCCACGGAGTCTGGACCAT (Forward), CTCTGCCAGTTTGTCCCTG (Reverse); UHRF1: AGGTCAATGAGTACGTCGATGC (Forward), TTCTCCGGGTAGTCGTCGT (Reverse); MCT4: CCATGCTCTACGGGACAGG (Forward), GCTTGCTGAAGTAGCGGTT (Reverse); HK2: GAGCCACCACTCACCCTACT (Forward), CCAGGCATTCGGCAATGTG (Reverse).

Cell transfection and RNA interference

For the lentiviral plasmids, 293 T cells were utilized for virus production. Briefly, 80% confluency of 293 T cells was applied to transfect with helper plasmids psPAX2/pMD2.G and lentiviral vector plasmids in 6-well plates. After incubation overnight, cells were replaced with 1.5 ml fresh medium, and the virus was collected after one day; cells were changed with the fresh medium again for a 2nd collection after another day of culturing. 0.45 mm filters were used to filter the virus. BLCA cell lines were seeded in 6-well plates to be 30–50% confluent at infection, 200 ml virus/well was applied, and 6–8 mg/mL polybrene was included to increase efficiency during the infection. Media were changed after 12–24 h infection, and the cells underwent appropriate antibiotic selection after more than 24 h incubation. The oligonucleotide sequences were designed and listed as the following (5'- > 3'): shSIRT6: CCGGTGGAAGAATGTGCCAAGTGTACTCGAGTACACTTGGCACATTCTTCCATTTTTG (Forward), AATTCAAAAATGGAAGAATGTGCCAAGTGTACTCGAGTACACTTGGCACATTCTTCCA (Reverse); shUHRF1: CCGGTGTGAAATACTGGCCCGAGAACTCGAGTTCTCGGGCCAGTATTTCACATTTTTG (Forward), AATTCAAAAATGTGAAATACTGGCCCGAGAACTCGAGTTCTCGGGCCAGTATTTCACA (Reverse); shMCT4: CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG (Forward), AATTCAAAAAGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGC (Reverse); shCtrl: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG (Forward), AATTCAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG (Reverse).

CCK-8 and colony formation assay

In the CCK-8 experiments, the tumor cells were placed in a 96-well plate at a density of 3,000 cells per well, with each well containing 100 µl of DMEM supplemented with 10% FBS. The original medium of each group was changed on separate days with 10 µl of CCK-8 solution diluted in 100 µl of complete culture medium, by the CCK-8 solution protocol (Dojindo, Kumamoto, Japan). Following a 2-h incubation period at 37 °C in the absence of light, we identified live cells by measuring their absorbance at 450 nm wavelength. BLCA cells stably expressed shRNA against SIRT6 or UHRF1, and the relative control cells were seeded. After cultivating for 10 days, 4% paraformaldehyde was used to fix the cells, followed by staining with 1% crystal violet. The colonies were counted subsequently.

Assays for migration and invasion

The migratory and invasive characteristics of tumor cells were evaluated via transwell assays performed in 24-well transwell plates (Corning, NY, USA). In migration tests, we introduced 40,000 BLCA cells into the top chamber with 200 µl of DMEM without serum and subsequently added 500 µl of DMEM with 30% FBS to the bottom chamber. To conduct the invasion tests, we applied a 1:6 combination of Matrigel (BD Biosciences) and DMEM to the chamber inserts, coating them with 50 µl, and the inserts were then incubated at 37 °C for 2 h. Subsequently, we introduced 80,000 cells into the top chamber. The bottom chamber contained 500 µl of DMEM with 30% FBS. Following a 48-h incubation period, we used a 4% paraformaldehyde solution to immobilize the cells that had migrated or invaded the bottom of the membrane. Then, the fixed cells were stained with crystal violet for 15 min. 5 arbitrary 100 × microscopic areas were chosen to enumerate the labeled cells using an IX71 inverted microscope manufactured by Olympus Corporation. We conducted the research by performing all our tests three times to ensure accuracy and reliability.

In vitro deacetylation assay

Briefly, SIRT6-KD BLCA cells were pre-treated with HDAC inhibitors (10 mM NAM, 50 nM TSA, 5 mM Sodium butyrate) for 6 h, then lysed in 300 mM KCl, 20 mM Tris–HCl (pH 7.9), 5 mM MgCl2, 0.2 mM EDTA, 10% glycerol, 0.5 mM DTT supplemented with 0.1% NP-40, protease inhibitors (Roche) and HDAC inhibitors (Sigma). UHRF1 was purified and enriched. The acetylation level of UHRF1 was monitored by western blotting with anti-pan-acetylation lysine antibodies.

Ubiquitin assay

HEK293T cells were transfected with an HA-ubiquitin construct together with indicated plasmids. After 48 h, cells were harvested in the immunoprecipitation buffer mentioned above by sonication. The ubiquitination of indicated proteins was immunoprecipitated and analyzed by western blotting with an anti-ubiquitin antibody.

Western blotting and immunoprecipitation

For western blotting, the protein extracts were produced using Laemmli loading buffer. Subsequently, they were separated using SDS polyacrylamide gels and deposited onto a PVDF membrane (Millipore). Finally, the membranes were probed with the corresponding antibodies, and the Bio-Rad system was used to visualize the immunoblots. To facilitate immunoprecipitation, the indicated cells that received the specified treatments were broken down in a solution containing 200 mM KCl, 20 mM Tris–HCl (pH 7.9), 5 mM MgCl2, 10% glycerol, 0.2 mM EDTA, and 0.1% NP-40. This solution was further treated with protease inhibitors from Roche Complete. Subsequently, the lysates of clear cells were treated overnight at 4 °C with the appropriate antibodies or control IgGs. Immunoprecipitates bound to beads were washed, rinsed in Laemmli loading buffer, and subjected to western blotting analysis. The following antibodies were utilized in our study: anti-SIRT6 (Abcam, ab289970), anti-UHRF1 (Abcam, ab213223), anti-MCT4 (Abcam, ab308528), anti-Hexokinase II (Cell Signaling Technology, CST#2867), anti-GAPDH (Abcam, ab8245).

Immunohistochemical (IHC) staining

For IHC experiments, 4μm formalin-fixed, paraffin-embedded (FFPE) tissue sections were deparaffinized with xylene and rehydrated with graded alcohol incubations. For SIRT6 (Abcam, ab289970), UHRF1(Abcam, ab213223) staining, pressurized antigen retrieval was performed at 125 °C for 4min (BioGenex, HK080-9K), followed by a 30 min depressurization period and an additional 30 min room temperature cooling period. Sections were treated with 3% H2O2 for 10min, permeabilized with 0.1% Tween-20 for 20 min, and blocked with 5% goat serum/0.3% Triton X-100 in phosphate-buffered saline (PBS) for 1h before incubation with primary antibody overnight at 4 °C. Subsequent incubations were performed as described with MYC staining; however, all washes were done with either PBS or PBS with 0.1% Tween-20. Whole slide bright field imaging was performed with the Zeiss Axio Scan.Z1 microscope (20 × objective lens).

Measurement of extracellular acidification rate (ECAR) and oxygen consumption rate (OCR)

Cellular mitochondrial function and glycolytic capacity were measured using the Seahorse Bioscience XF96 Extracellular Flux Analyzer, according to the manufacturer's instructions of Seahorse XF Cell Mito Stress Test Kit or Glycolysis Stress Test Kit (Seahorse Bioscience, Billerica, MA, USA). Cells were plated in XF96 Cell Culture Microplates (Seahorse Bioscience) at an initial cellular density of 4 × 104 cells/well the day before determination. Seahorse buffer consists of DMEM, phenol red, 25 mM glucose, 2 mM sodium pyruvate, and 2 mM glutamine. For ECAR measurement, 10 mM glucose, 1 μM oligomycin, and 100 mM 2-deoxy-glucose were automatically added to measure ECAR value. After monitoring baseline respiration, 1 μM oligomycin, 1 μM FCCP(Carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone), and 1 μM rotenone was automatically injected into XF96 Cell Culture Microplates to measure OCR. ECAR and OCR values were calculated after normalization to cell number.

Lactate/glucose detection

Cells were plated into 6-wells plate at a density of 2 × 105 cells/well for culturing 24h. Both cell lysis and medium were collected. For cell lysis, resuspend cell in 100ul assay buffer and sonicated for 3min (10s on, 12s off, 240W). Then centrifuge and collect the supernatant. Lactate detection was performed using Assay kits (ScienCell, Carlsbad, CA, USA, #8308) following the manufacturer’s instruction and then normalized to total protein.

Xenograft models and experiments

The BALB/c nude mice that were devoid of pathogens were acquired from the Slaccas in Shanghai. The housing and handling of all mice were conducted by the authorized procedures of the Ethics Committee of Ruijin Hospital, Shanghai Jiaotong University. We conducted preliminary studies to ascertain the requisite sample size of mice, and the assignment of mice to experimental groups was conducted randomly. The calculation of tumor volume was performed using the following formula:

$$}\left( }^} } \right)\, = \,0.\, \times \,}\left( }} \right)\, \times \,}\left( }} \right)^} .$$

Statistical analysis

Each experiment was conducted with a minimum of three replicates. All data were presented as mean ± S.D. or mean ± S.E.M., as mentioned in the figure captions. To compare the central tendency of normally distributed data, unpaired two-sided Student's t-tests were conducted assuming equal variance. Non-parametric Mann–Whitney U tests were used to analyze data sets that were not normally distributed. Statistical significance was determined for differences when the P-value was less than 0.05.