Antibodies and chemicals

All chemicals were purchased from Sigma-Aldrich; Czechia unless otherwise specified. The antibodies used in the study were purchased from Abcam and their specifications are listed below.

Table 1 Specifications of the primary antibodies used in the studyAnimals

C57BL/6 inbred mice strain was used in the experiment. Animals were housed in an animal facility (Institute of Molecular Genetics, ASCR, v. v. i.) under standard experimental conditions (constant temperature (23–24 °C), humidity (60 ± 5%) and 12-h light regime) This study was conducted in accordance with the Guide for the Care and use of Laboratory Animals (NIH Publication Eight edition 2011). The experimental protocol was approved by the Animal Care and Use Committee of the Institute of Molecular Genetics ASCR and carried out in accordance with the regular relevant guidelines and regulations (file number 17OZ9715/2019–18134).

EE2 exposure design

17α-Ethynylestradiol (EE2) was administrated in carbon-filtered drinking water ad libitum in two doses emulating the potential environmental dose (D1; 2.5ng/ml), contraceptive dose (D2; 2.5 μg/ml) and control group (vehicle); Nanimals = 5min – 8max per control/experimental groups according to the breeding outputs. The exposure of females of F0 generation started at 4th post-partum week and was terminated at 9th week in case of contraceptive dose D2 to avoid EE2 contraceptive effect during breeding, at 10th week, and demonstrate the potential trans-generational effect in F2 generation. Both males and females exposed to environmental dose D1 were exposed continuously. Males of F0 generation were exposed from post-partum 4th week till 10th week when they were mated with F0 females for 6 h overnight in cages without EE2 drinking water. F1 and F2 generations were then produced with respect to study potential paternally or maternally transmitted multi-generational, cumulative, and trans-generational effect of EE2 exposure (Fig. 1). Animals used for analysis were sacrificed at 11th week and reproductive organs including testes and epididymis were collected.

Fig. 1

Scheme showing in vivo exposure and breeding of control and experimental mouse groups in F0 generation to produce F1 and F2 progeny. Animals directly exposed to EE2 doses D1 and D2 are indicated by red rectangles, animals probing the potential trans-generational effect by blue rectangle. MC – male control; FC – female control; MD1 – male from lineage exposed to dose D1; FD1 – female from lineage exposed to dose D1; MD2 – male from lineage exposed to dose D2; FD2 – female from lineage exposed to dose D2

Testicular tissue analysisImmunohistochemistry staining and imaging

Testicular paraffine sections were deparaffinized using DIASOLV 2 × 5 min. After paraffine removal, samples were hydrated in decreasing ethanol series (100%, 90%, 70%) for 5 min in each solution followed by rinsing in distilled water and PBS. Antigen retrieval was performed in a pressure cooker for 15 min in 0,1 M citrate buffer pH 6. After, samples were cooled down at the room temperature for 30 min and permeabilized with Intracellular Staining Perm Wash Buffer 3 × 5 min (BioLegend, USA). Superblock solution (Thermofisher, USA) was applied prior to the primary antibodies for 1 h at room temperature in the humid chamber. Primary antibodies were diluted 1:200 in the Antibody diluent (Zytomed Systems GmbH, Germany) and applied overnight at 4 °C. The next day, samples were washed in PBS 3 × 5 min at room temperature (RT) with orbital shaking at 100 RPM. Secondary antibodies (AlexaFluor 488, 568, Abcam, GB) were diluted 1:500 in Antibody diluent and applied in a humid chamber for 1 h. Samples were washed 3 × 10 min, mounted using the Vectashield with DAPI (Vector Laboratories, USA) and sealed with nail polish. Testicular tissue sections were analyzed under Carl Zeiss Zeiss LSM 710 and LSM 880 inverted confocal microscopes and processed using Zen software (Fig. 2A-E).

Semi-automatic in situ fluorescent analysis of the histone PTMs in of testicular tissue sections

To assess the relative fluorescent intensities (RFI; and corresponding histones and histone PTMs abundancies) after indirect antibody-staining (primary antibodies specified in Table 1; Alexa Fluor 488/568, anti-mouse/anti-rabbit secondary antibodies, Abcam, GB) of the testicular tissue sections from control and experimental animals, the semiautomatic life image processing platform was utilized. First, the DAPI-positive image elements (cell nuclei) were identified using intensity mask (Fig. 2F) and the lumen centers were semi-manually marked. Then, signals from individual testicular cell populations (Fig. 2G) were isolated using PCA filters based on the cells size, roundness/complexity and distance from lumen (Figs. 2H and 3). The proper identification of individual cell populations by mask-based PCA filter was controlled by experienced histologist (LD) during the life image acquisition (400x). The collected RFI of the individual nuclei (Fig. 3, lower panels) were exported for subsequent statistical analysis.

Epididymal sperm analysisMouse sperm preparation

Both caudae epididymides were dissected, and sperm from their distal regions were released into a two 200 μL droplets of M2-fertilizing medium under paraffin oil (P-LAB, Czechia ) in a Petri dish and pre-tempered at 37 °C in the 5% CO2 atmosphere. After 15 min, medium with released sperm was collected into the Eppendorf tube and centrifuged for 5 min at 300 x g. Supernatant was removed and the pellet was gently resuspended in 500 μl PBS tempered to 37 °C and centrifuged again.

Sperm decondensation and immunofluorescent labelling

Sperm smeared on a glass slides were air dried for 2 h. After, the decondensing mix (0,385% DTT, 0,2% Triton X, 200 IU/ml Heparin dissolved I PBS) was applied on the heat block preheated to 37 °C for 1 min. After, decondensing solution was removed, slides were rinsed in PBS and fixed for 15 min in buffered formalin solution or 3,2% paraformaldehyde, depending on the antibody used for subsequent staining. Immuno-fluorescent staining was done using primary antibodies (Table 1) diluted 1:200 in the Antibody diluent (Zytomed Systems GmbH, Germany) and applied overnight at 4 °C. The next day, samples were washed in PBS 3 × 10 min at RT. Secondary antibodies (Alexa Fluor 488/568, anti-mouse/anti-rabbit secondary antibodies, Abcam, GB) were diluted 1:500 in Antibody diluent and applied in a humid chamber for 1 h. Samples were washed 3 × 10 min again and mounted using the Vectashield with DAPI (Vector Laboratories, USA) and sealed with nail polish. The stained decondensed mouse sperm smears were analyzed under Nikon Eclipse fluorescent microscope and/or Carl Zeiss Zeiss LSM 710 using NIS-Elements/Zen software. The consensus heat maps (Fig. 2K-M) were generated using similar approach described in [19, 20].

Fig. 2

Testicular tissue slides and epididymal sperm imaging and image analysis. (A) Tile scan of the entire testicular tissue section H3 staining; scale bar indicates 300 μm. (B) DAPI counter-staining of the corresponding section; scale bar indicates 300 μm. C-D) Magnification of the region of interest (ROI) of the section; scale bars indicates 200 μm (C) and 100 μm (D). E) Individual seminiferous tubule ROI; scale bar indicates 50 μm. F) Application of the mask for individual cell nuclei fluorescent signal isolation; scale bar indicates 50 μm. G) Isolation of signals from individual cell populations (black – all cells; blue – spermatogonia; green – spermatocytes; red/orange – spermatids and sperm. H-I) Visualization of individual cell populations blue – spermatogonia; green – spermatocytes; red/orange – spermatids and sperm in 3D Principal component analysis (PCA) plot (I) (see Fig. 3 for details) (H). Fluorescent signal of H3 staining (magenta) of decondensed sperm nuclei counter stained with DAPI (blue); scale bar indicates 10 μm (I). J) Relative fluorescent intensities (RFI) histograms over the sperm head stained with anti-H3 antibody. K-L) Alignment of fluorescent signals from nuclei (K), their super-position (L) for consensus heat map generation (M)

Fig. 3

Principal component and statistical analysis of the seminiferous tubule individual germ cells populations. Principal components (PC; upper row) and violin plots (bottom row) representing individual testicular/seminiferous tubule germ cell populations size, roundness/complexity and distance from lumen (PC plots x, y,z axes) and distributions of their RFI signals from H3 staining normalized per DAPI signal (violin plots). Nc – number of cells from individual populations with no observed statistically significant differences after random picking from 5 WT testicular sections (C1 – C5; tile scans; whole section life screenings). (A) Spermatogonial cell populations. (B) Spermatocyte cell populations. (C) Spermatid/sperm cell populations

DNA methylation analysis

Genomic DNA isolated from testicular and epididymal sperm samples underwent bisulfite conversion and purification using the EpiTect Fast DNABisulfite Kit (Qiagen) according to the manufacturer’s instructions. To quantify the methylation of single CpGs in Protamine 1(mPrm1) CpG island of the promoter region, 20 ng of bisulphate-treated DNA was amplified by PCR with specific primers.

These primers were designed to evaluate 10 CpG sites of the mPrm1 CpG island: Forward primer: AGAGGGTGTTGGTTTTAGGTTATAG; Reverse primer: AACCCAACCCAACCCTCTA; Sequencing primer ATGTTGTAGTAGTAAAAGTAGGA; Target sequence GTAGATGTYGTYGTYGTAGGYGAAGATGTYGTAGAYGGAGGAGGYGATGTTGTYGGYGGAGGAGGYGAAGTAAGTAGAGGGTTGGGTTGGGT. The PCR reaction contained 12.5 μl of PyroMark PCR Master Mix (Qiagen, Hilden, Germany), 2.5 μl of CoralLoad (Qiagen, Hilden, Germany), and 2.5 μl of 0.2 μM primer mix, together with DNA diluted with ddH2O in to a final volume of 25 μl. The following conditions were used for PCR: 95 °C for 15 min followed by 45 cycles at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s and a final extension at 72 °C for 10 min. The PCR products were pyrosequenced in Qiagen PyroMark Q24. We used the standard protocol and the required chemicals supplied by Qiagen. The received data was analyzed by Qiagen Q24 software (Version 2.0.6) (Qiagen, Hilden, Germany).

Statistical analysis

Individual numerical datasets were analyzed and plotted/graphically presented using GraphPad Prism 9 software (GraphPad Software, LLC). KW-ANOVA with subsequent Dunn’s multiple comparisons test were used to analyze the significance of the differences among control and experimental groups in Figs. 4C and 5E. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.