Mice

Adult male wild-type (WT) C57BL/6J mice (8 weeks old) from Beijing Viton Lever Laboratory Animal Technology Co., Ltd. (Charles River Laboratories, Beijing, China) were utilized, and adult male WT C57BL/6J mice (9 weeks old) and db/db mice with C57BLKS/J as background (9 weeks old) from Cyagen Biosciences (Suzhou) Inc. were utilized. Mice were housed in a facility with a 12-hour light/12-hour dark cycle, maintained at 23 ± 3 °C, and with a humidity range of 30–70%. All experiments adhered to the Guidelines for the Care and Use of Laboratory Animals at Jinan University and received approval from the Ethics Committee for Animal Experiments at Jinan University School of Medicine (IACUC-20220512-06 and IACUC-20231214-08).

Mouse DCM model and treatment

For T2DM mice derived from WT mice, following one week of acclimatization, the mice were fed a high-fat diet (HFD) comprising 60% fat, 20% carbohydrate, and 20% protein for a duration of 12 weeks. Subsequently, low-dose streptozotocin (STZ) (Sigma-Aldrich, St. Louis, MO, USA) injections (50 mg/kg body weight, intraperitoneally) were administered for 5 consecutive days to induce the T2DM model, and fasting blood glucose was tested after 2 weeks. For db/db mice, mice were fed with standard chow (STC) comprising 10% fat, 70% carbohydrate, and 20% protein. Mice exhibiting diabetic fasting blood glucose levels ≥ 11.1 mM for two consecutive days were categorized as T2DM mice [10]. Upon confirmation of successful modeling, diabetic mice were stratified into two groups: one receiving injections of an AAV9 viral vector carrying green fluorescent protein (GFP, AAV9-GFP) (Wz Biosciences Inc, Shandong, China) in the tail vein as a model control group, and the other receiving an AAV9 viral vector carrying FGF21 (AAV9-FGF21) as an intervention model group. Mice of the same age and sex maintained on a standard diet comprising 10% fat, 70% carbohydrate, and 20% protein were also divided into two groups as control groups and injected with AAV9-GFP or AAV9-FGF21. All mice were euthanized 12 weeks post-virus injection. Mice were anesthetized with Avertin, and intraperitoneal venous blood was drawn. Subsequently, press down on the back of the mice with left hand, clamp the right armpit of the mice with thumb, clamp the left forelimb with index and middle fingers, and use scissors to cut the head of the mice vertically at the neck with right hand, causing the mice to die due to marrowbrain rupture and massive bleeding, and then their hearts were removed.

Transmission electron microscopy (TEM)

Cardiac samples (1 mm × 1 mm × 1 mm) were immersed in electron microscope fixative. Following post-fixation, embedding, cutting, and mounting at the electron microscope core facility (Servicebio, Wuhan, Hubei, China), ultrathin sections were photographed using a Hitachi H-7800 transmission electron microscope (Hitachi, Tokyo, Japan).

Echocardiography

Mice were anesthetized via respiratory inhalation of isoflurane (Ruipu, Tianjin, China) and subjected to M-mode echocardiography using a Vevo2100/3100 imaging system (VisualSonics, Toronto, Canada). M-mode tracings were acquired from the left ventricle via a short-axis view at mid-nipple, allowing for assessments of ejection fraction and fractional shortening. Cardiac diastolic function was measured in apical four-chamber cardiac views and evaluated by the early to late diastolic transmitral flow velocity (E/A). Each value was averaged across at least three consecutive cardiac cycles.

Hematoxylin-Eosin (HE) staining

Standard HE staining was performed using an HE staining kit (G1005, Servicebio, Wuhan, China) according to the manufacturer’s protocol. Specifically, cardiac paraffin sections were dewaxed to water, subjected to hematoxylin staining and eosin staining sequentially, and finally dehydrated and sealed. Imaging was performed using TissueGnostics Strata FAXS P-S (TissueGnostics, Austria).

Masson staining

Standard Masson staining was performed using a Masson’s trichrome staining kit (G1006, Servicebio, Wuhan, China) according to the manufacturer’s protocol. Specifically, cardiac paraffin sections were dewaxed to water, placed in potassium dichromate overnight, and sequentially stained with hematoxylin, lachrymose red acid magenta, phosphomolybdic acid, and aniline blue, and finally dehydrated and sealed. Imaging was performed using TissueGnostics Strata FAXS P-S.

Prussian blue and diaminobenzidine staining

Tissue sections underwent sequential treatments in xylene and ethanol, followed by water washes. They were stained with a mixture of potassium ferrous hydride and hydrochloric acid, then with a diaminobenzidine solution, monitoring color development under a microscope. After rinsing, sections were counterstained with hematoxylin, differentiated, and returned to blue. Following dehydration and clearing in xylene, sections were mounted. Imaging was performed using TissueGnostics Strata FAXS P-S.

Immunohistochemical staining

Tissues were fixed in cold 4% paraformaldehyde and embedded in paraffin blocks. Following deparaffinization, dehydration, antigen repair, and sealing, tissue sections were incubated with antibodies at 4 °C overnight. Subsequently, all tissue sections underwent incubation with biotinylated goat anti-rabbit IgG for 20 min at room temperature, followed by incubation with streptavidin-horseradish peroxidase for 30 min. Finally, the tissues were stained using diaminobenzidine-H2O2 and hematoxylin. Imaging was performed using TissueGnostics Strata FAXS P-S.

Isolation and culture of neonatal mouse cardiomyocytes

To isolate and culture neonatal mouse cardiomyocytes, hearts from 1- to 3-day-old C57BL/6J mice (purchased from Southern Medical University Laboratory Animal Centre) were initially washed in phosphate-buffered saline (PBS) (Gibco, Carlsbad, CA, USA). Subsequently, the hearts were immersed in a mixture of trypsin (Gibco, Carlsbad, CA, USA) and PBS, placed on a shaker at 4 °C for 8 to 12 h. Following this, the hearts were incubated with complete medium containing 10% fetal bovine serum (Vivacell VC, Biological Industries, Israel) and 1% penicillin and streptomycin (Gibco, Carlsbad, CA, USA) in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA, USA) to neutralize trypsin; the liquid was then aspirated. The hearts were shaken at 37 °C for 10 min with DMEM spiked with 8.4% collagenase type II (Gibco, Carlsbad, CA, USA), and the cell suspension was then aspirated into a 50 ml centrifuge tube. The collected cell suspension in the centrifuge tube underwent centrifugation (1000 rpm, 5 min), and the supernatant was discarded. The precipitated cells were resuspended in complete medium and spread in petri dishes. After incubating in a humidified 5% CO2 environment for 1.5 h at 37 °C, dissociated cardiomyocytes were collected and added to the corresponding well plates and cultured for 48 h before being utilized for subsequent experiments.

In vitro model of diabetic cardiomyocyte injuries

For the in vitro model of diabetic cardiomyocyte injuries, cardiomyocytes were incubated for 48 h in complete medium with high glucose (HG; 33 mM) along with high fat (0.2 mM palmitic acid, PA), and cardiomyocytes cultured with low glucose (LG; 5.5 mM) were used as controls.

Construction of AAV9 vectors for overexpression or knockdown of FGF21

Coding DNA sequences of mouse FGF21 were amplified by polymerase chain reaction from FGF21 plasmid using the forward primer 5′- CGCAAATGGGCGGTAGGCGTG′ and the reverse primer 5′- TCGCCGGACACGCTGAACT′ and were then inserted into the plasmid to construct the AAV9-FGF21 overexpression vector.

Transfection of cardiomyocytes with plasmid or siRNA

Transfection of cardiomyocytes with plasmids (Wz Biosciences Inc, Shandong, China) and siRNA (Beijing Tsingke Biotech Co., Ltd.) was performed using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, USA) and X-treme gene siRNA transfection reagent (Roche, Basel, Switzerland), respectively. The sequences of siRNAs for mouse FGF21 were: 5′-GUGUCAAAGCCUCUAGGUU-3′ and 5′-AACCUAGAGGCUUUGACAC-3′; for mouse FTH1: 5′-GACACGGUGAUGAGAGCUA-3′ and 5′-UAGCUCUCAUCACCGUGUC-3′; for mouse FTL: 5′-GUCUCCUCGAGUUUCAGAA-3′ and 5′-UUCUGAAACUCGAGGAGAC-3′.

Mitochondrial membrane potential (MMP)

JC1 dye (Thermo Fisher Scientific Inc, T3168, Waltham, MA) was utilized to detect MMP in cardiomyocytes. JC1 accumulates in mitochondria in a potential-dependent manner, causing a shift in fluorescence emission from green (~ 529 nm) to red (~ 590 nm). The detection wavelengths were 488 nm (J-monomers) and 532 nm (J-aggregates). Cardiomyocytes were stained with JC1 dye (2 µM) and incubated for 30 min at 37 °C, 5% CO2. Observation was conducted using a laser scanning confocal microscope (LSCM) (Leica, STELLARIS 8, Weizler, Germany), and fluorescence intensity was measured by the instrument’s own software. Mitochondrial depolarization was indicated by a decrease in the red/green fluorescence intensity ratio (ΔΨm).

Lipid ROS

Lipid ROS levels were measured using the lipid peroxidation sensor BODIPY™ 581/591 C11 (Thermo Fisher Scientific Inc, D3861, Waltham, MA), with excitation/emission maxima of 581/591 nm in a reduced state, which shift to 488/510 nm upon oxidation. Cardiomyocytes were incubated with BODIPY™ 581/591 C11 (5 µM) for 30 min at 37 °C, 5% CO2. Changes in the green to red fluorescence ratio indicated lipid peroxidation. LSCM was used for observation, and fluorescence intensity was measured by the instrument’s own software.

Intracellular Fe2+

FerroOrange (Dojindo, F374, Kyushu Island, Japan), with excitation/emission wavelengths of 532/580 nm, was employed to measure intracellular Fe2+  content following the manufacturer’s instructions. Cardiomyocytes were incubated with FerroOrange (1 µM) for 30 min at 37 °C, 5% CO2. LSCM was used for observation, and fluorescence intensity was measured by the instrument’s own software.

Co-immunoprecipitation (Co-IP) and identification of interacting proteins

Lysates from primary cardiomyocytes underwent Co-IP using an IP antibody and A/G magnetic beads (MedChemExpress, HY-K0202, Monmouth Junction, NJ, USA), as specified in the instructions, followed by resolution using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analysis by immunoblotting. The gel at the target position was cut and sent to Novogene Technology Co. (Beijing, China) for protein profiling by liquid chromatography-tandem mass spectrometry. The following antibodies were used in Co-IP: FGF21 (ab171941) from Abcam (Cambridge, MA, USA), FTH1 (sc-376594)/FTL (sc-74513) from Santa Cruz Biotechnology (Dallas, TX, USA).

Immunofluorescence

Isolated cardiomyocytes were adhered to sticky slides and cultured for 48 h before being fixed in 4% paraformaldehyde. After rinsing with PBS, cardiomyocytes were treated with 0.5% Triton X-100 for 8 min, followed by blocking with 10% normal goat serum for 1 h at room temperature. Subsequently, the slides were covered with FGF21 (1:500) and incubated at 4 °C overnight. After rinsing with PBS, a fluorescein 488 antibody (1:500) was added and incubated for 1 h at room temperature. After rinsing with PBS, FTH1 (sc-376594, 1:500)/FTL (sc-74513, 1:500) from Santa Cruz Biotechnology (Dallas, TX, USA) were introduced to the slides and incubated overnight at 4 °C. After rinsing with PBS, nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, D9542, St. Louis, MO, USA). Mounting Medium, Antifading (Bei jing Solarbio Science & Technology Co., Ltd.) was used to reduce fluorescence quenching and immunofluorescence was examined using LSCM.

Quantitative polymerase chain reaction (qPCR)

Total RNA from cardiomyocytes or tissues was extracted using Trizol reagent. After DNase treatment, RNA was reverse-transcribed using the ReverTra Ace qPCR RT Kit (TOYOBO, Osaka, Japan). qPCR was performed with PerfectStart Green qPCR SuperMix (TransGen Biotech, Beijing, China). Relative gene expression was quantified based on Ct values, normalized against β-actin as an internal control. Primer sequences are available in Table S1.

Protein extraction and western blotting (WB)

Total protein samples from cardiomyocytes and tissues were extracted using RIPA lysis buffer (Beyotime, P0013B, Shanghai, China), supplemented with phenylmethylsulfonyl fluoride (Beyotime, ST506, Shanghai, China). Proteins were separated by SDS-PAGE and subsequently transferred onto polyvinylidene fluoride membranes. The membranes were blocked in Tris-buffered saline with 5% milk and incubated overnight with primary antibodies at 4 °C, with β-actin and β-tubulin serving as internal controls. Following washing with Tris-buffered saline containing Tween, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (anti-rabbit (7074) and anti-mouse (7076), both at 1:2000, Cell Signaling Technology, Boston, USA) for 1 h at room temperature. The membranes were then scanned and analyzed using an appropriate developer. The following antibodies were employed in WB: β-actin (BM5422, 1:5000) and β-tubulin (A05397-1, 1:5000) from Boster (Wuhan, China); FGF21 (ab171941, 1:1000) from Abcam (Cambridge, MA, USA); FTH1 (AB32180, 1:1000) and FTL (AB32425, 1:1000) from Absci (Oregon, USA); GPX4 (67763-1-Ig, 1:1000) from Proteintech (Wuhan, China); and ATF4 (sc-390063, 1:100) from Santa Cruz Biotechnology (Dallas, TX, USA).

Cell counting Kit-8 (CCK8), malondialdehyde (MDA), and lactate dehydrogenase (LDH) assays

The CCK8 (Life-iLab, AC11L054, Shanghai, China), MDA (Nanjing Jiancheng Bioengineering Institute, A003-4-1/A003-1-2, Nanjing, China), and LDH assay kits (Nanjing Jiancheng Bioengineering Institute, A020-2-2, Nanjing, China) were utilized to assess cell viability, MDA levels, and LDH levels, respectively, following the manufacturers’ instructions.

Other reagents and antibodies

The following reagents were utilized: Bafilomycin A1 (BafA1) (Sigma-Aldrich, B1793, St. Louis, MO, USA), MG132 (MedChemExpress, HY-13259, Monmouth Junction, NJ, USA), 4-hydroxynonenal (4-HNE) (Invitrogen, MA5-27570, Carlsbad, CA, USA), Ferrostatin-1 (Fer-1) (MedChemExpress, HY-100579, Monmouth Junction, NJ, USA), and Artesunate (Art) (MedChemExpress, HY-N0193, Monmouth Junction, NJ, USA).

Statistical analysis

Data are presented as mean ± SEM. Student’s t-test was employed for comparisons between two groups. For comparisons involving more than two groups, one-way ANOVA followed by Tukey’s post hoc analysis was applied for normally distributed variables. For non-normally distributed variables, a Kruskal-Wallis test with Dunn’s multiple comparison post hoc analysis was utilized. All statistical analyses were conducted using GraphPad Prism version 8.0 software (San Diego, CA, USA). Differences with a p-value < 0.05 were considered statistically significant.