Construction of the DSS-induced murine colitis model

Male C57BL/6 mice at 6- to 8-week old were purchased from JOINN (Suzhou, China) with license No. SCXK (Su) 2018-0006. All animal experiments were approved by the Ethics Committee of Animal Experiments of Soochow University. After 3 days of acclimatization, mice in the DSS group were fed 3% DSS (216,011,080, MP Biomedicals) for 7 days. The control group received distilled water. The mice were observed daily for body weight and colitis index. On the 8th day, the mice were euthanized, and colon tissues were harvested.

Assessment of disease activity index (DAI) score

The severity of colitis was recorded by assessing disease activity through observation of body weight, stool consistency and bleeding stool daily. Briefly, weight loss: (0 points = no weight loss, 1 points = 1–5%, 2 points = 5–10%, 3 points = 10–20%, 4 points = > 20%); stool consistency: (0 points = normal, 2 points = loose stool, 4 points = watery stool); bleeding stool: (0 points = normal, 2 points = slight bleeding, 4 points = bloody stool) [24].

Cell culture and treatment

The murine macrophage line RAW264.7 was obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and maintained in high glucose DMEM (11995-065, Gibco) with 10% FBS (10,270,106, Gibco) in humidified air with 5% CO2 at 37 ℃. RAW264.7 cells were challenged with 100 ng/mL LPS (L4391, Sigma) and 10 ng/mL IFN-γ (Z02916, GenScript) for the indicated times. For NF-κB inhibition, RAW264.7 cells were pretreated with 10 µM JSH-23 (HY-13,982, MCE) for 2 h before LPS/IFN-γ stimulation.

Cell transfection

Cells were transfected with YTHDC1 overexpression, YTHDC1 knockdown or Beclin1 knockdown lentiviruses (Genechem, China) followed by puromycin (6 µg/ml, A1113803, Gibco) selection. The sequences of shRNAs targeting YTHDC1 were listed below: shYTHDC1#1: GGAAGAGGTGAACTCTGAAGA, shYTHDC1#2: GCATATCACCCATTGTCTTTG, and shYTHDC1#3: GCGTCGACCAGAAGATTATGA. The sequences of shRNA targeting Beclin1 were listed below: shBeclin1: GATGGTGTCTCTCGAAGATTC.

RNA immunoprecipitation (RIP) assay

A Magna RIP Kit (17–700, Millipore) was used to perform the RIP assay in accordance with the manufacturer’s instructions. Briefly, cells were lysed with RIP lysis buffer on ice for 5 min. YTHDC1 (1:50, 77,422 S, Cell Signaling Technology) and corresponding IgG antibodies were incubated with magnetic beads at room temperature (RT) for 30 min. Then, cell lysates were immunoprecipitated with the bead-antibody complex at 4 °C overnight. The next day, the RNA‒protein complex was treated with 10% SDS and proteinase K, and then RNA was extracted from the supernatant for qRT‒ PCR analysis.

MeRIP-qPCR

SRAMP (http://www.cuilab.cn/sramp/) [25] was employed to predict the m6A modification sites of mouse Beclin1 mRNA. The EpiQuik CUT&RUN m(6)A RNA Enrichment (MeRIP) Kit (P-9018-24, Epigentek) was used to perform the MeRIP assay. Briefly, 10 µg of RNA samples were incubated with m(6)A antibody and Affinity Beads in Immuno Capture Buffer for 90 min at RT. Nonimmune IgG was used as a negative control. Then, samples were fragmented by Nuclear Digestion Enhancer and Cleavage Enzyme Mix for 4 min at RT. After discarding the supernatant, the beads were washed with WB wash buffer and protein digestion buffer, followed by incubation with protein digestion solution at 55 ℃ for 15 min. Finally, RNA samples were purified and resuspended in elution buffer for 5 min at RT to release RNA from the beads.

Real-time PCR

Total RNA was extracted from RAW264.7 cells using TRIzol (15,596,026, Invitrogen) according to the manufacturer’s instructions. cDNA was obtained using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo). qRT‒PCR was performed using SYBR Green Master Mix (4,367,659, Applied Biosystems). β-actin was used as the internal normalization control, and relative expression was measured using the 2−△△Ct method. Primers are shown in Table 1.

Table 1 Primers for qRT‒PCRImmunostaining

For immunofluorescence staining, cryosections were dried at 37 ℃ in an incubator for 30 min. Subsequently, the sections were rinsed three times with PBS for 5 min each, followed by permeabilization with 0.5% Triton X-100 for 15 min. After blocking with 5% BSA for 2 h, the slides were incubated with anti-YTHDC1 (1:50, ab259990, Abcam) and anti-F4/80 (1:200, ab6640, Abcam) primary antibodies overnight at 4 ℃. Then, the sections were rinsed with PBS, stained with the corresponding fluorescent secondary antibody at RT for 2 h in the dark and covered with Dapi-Fluoromount-G. All images were acquired under a confocal microscope.

Western blot analysis

Colon tissue or RAW264.7 cells were lysed in RIPA lysis buffer (CW2333S, CWBIO) containing 1% protease (CW2200S, CWBIO) and phosphatase inhibitors (B15001, Bimake). Proteins were resolved by SDS‒PAGE and electrotransferred to polyvinylidene difluoride membranes. 5% skim milk or BSA was used to block the membranes for 2 h at RT. The membranes were incubated with primary antibodies against YTHDC1 (1:1000, ab259990, Abcam), iNOS (1:1000, ab178945, Abcam), p-p65 (1:200, sc-136,548, Santa Cruz), p65 (1:1000, 10745-1-AP, Proteintech), SQSTM1 (1:50000, ab109012, Abcam), Beclin1 (1:500, ab210498, Abcam), LC3A/B (1:500, 4108s, CST), and β-actin (1:2000, 66009-1-Ig, Proteintech) at 4 ℃ overnight. The next day, after washing with TBST, the PVDF membranes were incubated with HRP-linked secondary antibodies for 2 h at RT. The bands were visualized with enhanced chemiluminescence (ECL) substrates and quantified by ImageJ software.

RNA stability assay

Following transfection, RAW264.7 cells were incubated with 5 µg/ml actinomycin D (HY-17,559, MCE) for 0, 3, and 6 h. Then, the cells were collected to isolate RNA. Finally, qRT‒PCR was performed to detect Beclin1 mRNA expression.

Statistical analysis

Data were compared by unpaired Student’s t test between two groups and one-way or two-way ANOVA among multiple groups followed by Bonferroni post hoc test. The statistical analysis was performed using GraphPad Prism 8. All data are presented as the means ± SEMs. p < 0.05 was considered significant.