Clinical ethics approval

Hypertrophic scar (HS), as well as adjacent normal skin (NS), atrophic scar (AS) and adipose tissues were harvested from patients who underwent plastic surgery in the department of burns and cutaneous surgery, Xijing Hospital, Xi'an. The work was performed in accordance with the Code of Ethic of the World Medical Association (Declaration of Helsinki). All participates were informed of the objective as well as process of this research, promised to supply their discarded tissues, and signed informed consent. The study was authorized by Ethics Committee of Xijing Hospital affiliated with Air Force Medical University (KY20202103-F-1).

Cell culture

HUVEC were obtained from Cell Bank of Chinese Academy of Sciences (Shanghai, China), and cultured in endothelial cell medium (ECM, Sciencell #1001, San Diego, USA) supplemented with 5% FBS, 1% endothelial cell growth supplement and 1% penicillin–streptomycin in an incubator with 5% CO2 at 37℃. When HUVEC were grown to approximately 70%-80% confluence, stimulated with or without different concentrations of H2O2 (diluted with DMEM, 20 μM, 50 μM, 100 μM, 200 μM; 30% H2O2, Tianjin Tianli Chemical Reagents Co., LTD) in the presence/absence of ADSC-Exo (20 μg/ml) for 24 h. Mir-486-3p mimics (100 nM/L), mir-486-3p inhibitors (200 nM/L) as well as their corresponding negative control (100 nM/L), or Sirt6 overexpression plasmid (OE-sirt6, EcoRI/BamHI cloning site) and empty vector of control plasmid pEX-1(Pgcmv/MCS/EGFP/Neo) (100 nM/L) (Genepharma, Shanghai) were transfected with lipofectamine 2000 Reagent kit (Invitrogen), the specific sequences shown in supplementary Table 1. HUVECs were simultaneously treated with 200 μM H2O2 and 20 μg/ml ADSC-Exo (20 μg/ml ADSC-Exo and 100 nM/L mir-486-3p mimics or 200 μM H2O2 and 200 nM/L mir-486-3p inhibitors) in a well of six-well plate. The mRNA samples were harvested after 24 h and the protein detection was performed after 48 h. The morphological change of HUVEC were observed by Olympus TH4-200 (IX70/71) (Table 1).

Table 1 The primer sequences of genes mentioned in the experiment

ADSCs were isolated as previously reported (Bai et al. 2010). Briefly, the shredded adipose tissues underwent enzymatic digestion with type I Collagenase (1 mg/ml, 0.1%, Sigma, SCR103) at 37℃ on the shaker for 50 min, then centrifuged and discarded the supernatants, cells were resuspended with ADSCs special medium (Ori cell HUXMD-90011, Cyagen, China) to T25 flashes.

Flow cytometry

ADSCs at passages 3–5 were enzymatically dissociated using a 0.25% typsin-EDTA solution, centrifuged at 1000 rpm, 4℃, 5 min. Cells were washed with PBS and subsequently incubated with fluorescence-conjugated antibodies (CD105-PE, CD29-PE, CD34-FITC, CD44-PE, CD45-FITC, CD90-PE) for 30 min at 37℃ in the dark and examined by FACSAria™ III (BD Biosciences, USA).

Adipogenic and osteogenic differentiation

Adipogenic and osteogenic differentiation were utilized to prove the multilineage of ADSCs. ADSCs at 80–90% confluence was incubated with the specific medium of adipogenic differentiation (OriCell, HUXMD-90031, Cyagen) for two weeks and osteogenic differentiation (OriCell, HUXMD-90021, Cyagen) for three weeks. Subsequently, the paraformaldehyde-prefixed ADSCs were identified with lipid droplet and calcium nodules under an optical microscope through Oil Red O Solution and Alizarin Red S. Images were obtained by Evos FL Auto2 (Invitrogen, Thermo Fisher Scientific).

The acquisition, qualification and internalization of Exo

Exo was isolated as previously described (Logozzi et al. 2020). Briefly, the conditioned supernatants were subjected to centrifugate by 300 × g, 10 min, 4℃, followed by 2000 × g, 10 min, 4℃ and then 10000 × g, 30 min, 4℃. The obtained medium was filtered using a Millipore filter with a pore size of 0.22 μm, followed by ultracentrifugation by 100000 × g, 70 min, 4℃. Acquired pellets were dissolved with 26 ml PBS, then subsequently executed to another ultracentrifugation by 100000 × g, 70 min, 4℃. A Ti70 rotor of Beckman Coulter was utilized (Optima XPN-100 Ultracentrifuge). We ultimately resuspended exosomes with 200 μl PBS and stored at -80℃. BCA protein assays (Boster, Wuhan) was used to examine the concentrations of ADSC-Exo by infinite M200 PRO (TECAN). The concentration of exosome was standardized to 2 μg/μl on average.

ADSC-Exo were identified by the morphological and immunological detections. Immunoblotting of the specific markers (CD9 and CD63) determined the protein expressions, transmission electron microscope (TEM) represented the specific morphology, nanoparticle tracking analysis (NTA, ZetaView®system) detected the distributions of particle size of Exo, respectively. PKH26-labeled ADSC-Exo were performed to examine the internalization in HUVEC (Sigma-Aldrich). Briefly, Exo (diluted with 250 μl PBS) was diluted with 250 μl Diluent C, and then mixed with 2 μl PKH26 diluted in 250 μl Diluent C. The mixture was allowed to stand for 5 min to confirm a final PKH26 concentration of 1 × 10−6 M. Subsequently, it was neutralized with 5%BSA in PBS. The resulting mixture was centrifuged by 100000 × g, 70 min, 4℃. Finally, the obtained Exo was used to stimulate HUVEC.

Immunohistochemistry staining

The paraffin-embedded sections were deparaffinized using dimethylbenzene, rehydrated with a series of ethanol dilutions, and subjected to antigen retrieval with Citrate-EDTA antigen retrieval solution (Beyotime, Shanghai). The activity of endogenous peroxidase was eliminated by utilizing 3% H2O2 at 37℃. Goat serum reduced the non-specific binding, the sections were then incubated with primary antibodies against α-SMA (CST, 1:300) and Col3 (Abcam, 1:200) at 4 °C overnight, incubated with the secondary antibody in the following day and visualized with DAB (SP Rabbit & Mouse HRP Kit, Cwbio, Beijing), followed by counterstaining nucleus with hematoxylin and observing under a light microscope (Evos FL Auto2, Invitrogen, Thermo Fisher Scientific).

Immunofluorescence staining

HUVEC fixed in 4% paraformaldehyde (105cells/well for 24-well plates) were permeabilized at room temperature with 0.1% TritonX-100, with 1% BSA blocking, subsequently incubation with primary antibodies against α-SMA (CST, 1:100), CD31 (Abcam, 1:100), VE-Cadherin (CST, 1:200), Vimentin (Proteintech, 1:100) and Ki67 (Proteintech, 1:100) overnight at 4℃. The paraffin-embedded sections were subjected to immunofluorescence staining, as previously mentioned, targeting α-SMA (Abcam, 1:200) and CD31 (CST, 1:200). The next day, cells or sections were incubated with secondary antibodies, labeled with either Cy3 or FITC (diluted with 1:50, Zhuangzhibio, Xi'an) at 37℃ for 1 h. Finally, counterstaining nucleus with DAPI (Boster, Wuhan), the pictures were captured using Evos FL Auto2 (Invitrogen, Thermo Fisher Scientific). The cytoskeleton staining of F-actin fibers was performed by incubating cells with Phalloidin (1:500, Abcam). The mean fluorescence intensity and immunofluorescence colocalization analysis were quantified by Fiji software (downloaded from http://fiji.sc).

CCK8

Cell viability was detected by cell counting kit-8 (CCK8) assay (Meilunbio, Dalian). Briefly, HUVEC (104 cells/100 μl) in 96-well plates were exposed to gradient concentrations of H2O2 (20, 50, 100, 200 μM) to last for 24 h. Addition of CCK8 reagent (10 μl/well) and incubation at 37℃ for 0.5 h or 1 h, the absorbance at OD450nm was measured using infinite M200 PRO (TECAN, Shanghai).

Western blotting

Cellar lysates was centrifuged and detected the concentration of protein samples using the BCA protein assays (Beyotime, Shanghai). Subsequently, 25 μl of a 5 × loding buffer was pipetted to supernatants and degenerated at 100℃ for 10 min in a metal bath. The protein samples (30 μg) were separated using a 8–12% SDS-PAGE gel, subsequently electrophoretically transferred onto PVDF Transfer Membranes (0.45 μm pore size, Millipore, USA) at a voltage of 100 V for a duration of 40-90 min. Following transfer and blocking in defatted milk, the membranes were incubated with primary antibodies (dilution ratio/1:1000) against CD31(Proteintech, CST), VE-Cadherin (Boster, CST), α-SMA (Proteintech, CST), Nrf2 (Proteintech), Vimentin (Proteintech), SM22α (Boster), HO-1(Proteintech), ZO-1 (Proteintech), Sirt6 (CST), Nox4 (Proteintec), p-Smad2/3 (CST), Smad2/3 (CST), TGFβ1(Proteintech) and GAPDH (Zhuangzhi Bio) at 4℃ overnight (listed in Table 2). The next day, washing the membranes with TBST, incubation with HRP-conjugated secondary antibodies (Proteintech, dilution ratio/1:3000) at room temperature for 90 min, and visualization by utilizing an enhanced-chemiluminescence system (ECL Kit, Boster) on a ChemiDoc™ Imaging System (Bio-Rad). The quantitative analysis of protein intensity bands was performed by Image J software and normalized to GAPDH levels.

Table 2 Antibodies used in the studyTranswell migration assays

The ability of migration was analyzed using an 8 μm pore size inserted in a 24-well plate (PI8P01250, Millipore), as previously described. Cells (1 × 104 cells/well) were inoculated into the upper chamber. 500 μl medium, including the stimulation of H2O2 (200 μM), ADSC-Exo (20 μg/ml) and mir-486-3p (100 nM/mimics, 200 nM/ inhibitors), was transferred to the lower chamber. Experiencing an 8-h incubation, fixation and subsequently staining with crystal violet (Heart Biological technology, Xi'an), HUVEC distributed in the inner layer gently wiped off with cotton swabs. The migrated endothelial cells were analyzed by Fiji software (http://fiji.sc).

Matrigel assay

The yellow tips were pre-cooled, and a 12/24 well plate along with Matrigel matrix (356254, Corning, BD Biosciences) was prepared in advance by storing them in a refrigerator at 4℃ for one day. Each well of the 24-well plates was uniformly coated with 200-300 μl of cold Matrigel, followed by incubation at 37℃ for half an hour to allow Matrigel solidification. Meanwhile, HUVEC were enzymatically dissociated using a 0.25% Typsin-EDTA solution. Subsequently, 2 × 105cells/well of HUVEC were exposed to 200 μM H2O2, 20 μg/ml ADSC-Exo, 100 nM mir-486-3p mimics and 200 nM mir-486-3p inhibitors. Photographic documentation was performed at time points of 2 h, 4 h, 6 h to observe the formation of tubular structures. The quantity analysis of branch points and the length of tube was quantified through Image J software (https://imagej.net/ij/) with blood vessels plug-in.

qPCR

The concentration of RNA lysates was measured (Epoch, BioTek instruments, Inc.). For reverse transcription, 500 ng RNA for synthesizing cDNA with Prime Script™ RT Master Mix kit (Takara, Japan), while 800 ng miRNAs with miRNA 1st strand cDNA synthesis kit (Accurate biology, Changsha) on a C1000™ Thermal Cycler system (Bio-Rad). The amplification of cDNA was executed with SYBR Premix Ex TaqTM II kit (Takara, Japan) or UltraSYBR mixture (Cwbio, Beijing) on a CFX96™ Real-Time System (Bio-Rad). Genes expression was confirmed by performing every reaction in triplicate, with regarding GAPDH as an inner control. U6 was utilized as an internal normalization for mir-486-3p. The primer pairs appeared in the experiment were documented in Table 1, with each experiment being replicated thrice. Relative quantification was conducted following the ΔΔCT method, and results were represented in the linear form using the formula 2-ΔΔCT.

miRNAs-sequence

The enrichment of 18–30nt RNA molecules by polyacrylamide gel electrophoresis (PAGE), 36-44nt RNAs by the addition of 3'adapters and the subsequent administration of 5' adapters, then the PCR amplification of the ligation products through reverse transcription, the enrichment of 140-160 bp size of PCR products were generated a cDNA library and sequenced using Illumina Novaseq6000 by Gene Denovo Biotechnology Co. (Guangzhou, China). The differential expression analysis of miRNAs was performed by edgeR software between two different groups or samples. miRNAs were identified with a fold change ≥ 1.5 and p value < 0.05 in a comparison as significant differentially expressed miRNAs. The raw miRNA sequencing data of this study had been deposited in the NCBI Sequence Read Archive (SRA) database under the accession code PRJNA952693 (https://ncbi.nlm.nih.gov/).

Luciferase reporter assay

The RNAhybrid database predicted the binding sequences of mir-486-3p and Sirt6. Sirt6 3'UTR containing wild-type (WT) or mutant (Mut) binding site of human mir-486-3p were designed and synthesized by GenePharma (Shanghai, China). 293 T were co-transfected with the corresponding plasmids and human mir-486-3p mimics/mimics-NC or inhibitors/inhibitors-NC with Lipofectamine 2000 (Invitrogen). To construct of luciferase reporter gene vector containing Sirt6 promotor, the full-length Sirt6 promotor containing wild or mutant type was respectively cloned into pGL3-basic vectors (Genecreate, Wuhan, China), and co-transfected with or without Sirt6 overexpression vector. After 48 h of incubation, the activities of firefly and Renilla luciferase were measured using the Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA). The binding sequences of miRNA and target gene were shown as follows, hsa-miR-486-3p: CGGGGCAGCTCA GTACAGGAT; Sirt6-WT: CTGTGCTCCAGGCCAGGGGTTACACCTGCCCT; Sirt6-MT: TCACATCCCAGGCCAGAAATTA CACTCATTTC.

Animal experiments

C57BL/c male mice (Six- to eight-week-old) were acquired from Experimental Animal Center of Air Force Medical University. All protocols and experiments were authorized by Laboratory Animal Welfare and Ethics Committee of the Air Force Medical University (Approval number: 20231002) and executed in strict accordance with the requirements of above-mentioned institutions (Xi'an, China). The animals were randomly allocated into the following four groups: Ctrl/PBS groups, Exo group (70 μg dilution into 100 μl PBS per mouse), Exo + mir-486-3p mimics NC groups and Exo + Lv3-mmu-mir-486-3p mimics groups (1 × 109TU/ml virus titer in PBS, Genepharma, Shanghai). The mice were anesthetized with isoflurane, the hair on their dorsal surface was removed, and a 1 cm in a diameter of full-thickness skin defect model was created and splinted with a silicone ring possessing super adhesive properties. ADSC-Exo and the lentivirus were administrated into the wound through subcutaneous injection with a 27-gauge needle to last for either 5 days or 3 days, respectively. The wounds were documented on days 3, 5, 7, 10, 14. Following a two-week period, the wound tissues of euthanized mice were collected for the follow-up histological staining. Each group consisted of a minimum of six mice.

The paraffin-embedded samples sections were utilized for H&E and Masson trichrome staining (Jiancheng Bioengineering Institute, Nanjing) to assess pathological change and collagen deposition according to the manufacturer's instructions. The total mRNA and protein of wound tissues were extracted using a tissue lyser servicer, and centrifuged. The supernatants were utilized for subsequent concentration determination of mRNA and protein levels of corresponding molecules.

ROS assay

We detected oxidative stress levels using the Reactive Oxygen Species Assay Kit (Beyotime Biotechnology, Shanghai). 70–80% confluence of HUVEC in six-well plates were stimulated with H2O2, ADSC-Exo and catalase. After 24 h, cells were treated with tryptic digestion, and stained with DCFH-DA (10μΜ/L) at 37℃ on the shaker in the absence of light. Following another round of PBS, labeled HUVEC in 300 μl of serum-free medium was subjected to flow cytometry analysis using an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

Statistical analysis

The data in the study were analyzed utilizing GraphPad8 Prism software. Each operation was repeated at least three times, and the results were presented as mean ± standard error of the mean. Statistical comparisons between two groups were performed using Student′s T test. p < 0.05 was considered statistically significant.