Materials and reagents

NSC319726 (PubChem CID: 5,351,307) was purchased from MedChemExpress (Cat. HY-18634). Ammonium tetrathiomolybdate (TTM) was purchased from Sigma-Aldrich (Cat. 323,446). Retinoic acid was obtained from Meilunbio (Cat. 302–79-4).

The study utilized the following antibodies: rabbit anti-DDX4 (Bioword, BS72725, IF:1:200, WB:1:1000), mouse anti-SYCP3 (Abcam, ab97672, IF:1:200, WB:1:1000), rabbit anti-CYP17A1 (Bioword, MB10800, WB:1:1000), rabbit anti-ZO-1 (Bioword, BS71522, WB:1:1000), rabbit anti-Vinculin (Bioword, BS62273, WB:1:1000), rabbit anti-β-Catenin (Abclonal, A11932, WB:1:1000), mouse anti-GAPDH (Bioword, MB001, WB:1:1000), rabbit anti-DLAT (Proteintech,13,426–1-AP, 1:2000), rabbit anti-LIAS (Proteintech, 11,577–1-AP, 1:1000), rabbit anti-FDX1 (Bioword, BS71332, WB:1:1000), rabbit anti-STRA8 (OmnimAb, OM292470, IF:1:200, WB:1:1000), and rabbit anti-RDH10 (Affinity Biosciences, DF12105, IF:1:200, WB:1:1000).

Ethics statement

The rodents were allowed to adjust to the laboratory settings for one week at a temperature of 22 ± 2℃ and humidity of 55 ± 5%, with water and food freely available. All animal-related research has been authorized by the Experimental Animal Ethics Committee of Jilin University, China, with the approval number SY202312009.

Animals and treatments

Male ICR mice that were eight weeks old were acquired from Jilin University's Experimental Animal Center (Jilin University, Changchun, China). All the mice were weighed and randomized into subgroups by generating a random number. The groups consisted of a control group (n = 8 mice were injected intraperitoneally with solvent daily) and an NSC319726 group (n = 8 mice were injected intraperitoneally with 1 mg/kg of NSC319726 daily for five weeks).

To treat testis damage induced by NSC319726, the mice were co-treated with copper chelator tetrathiomolybdate (TTM) and retinoic acid (RA). The healthy male ICR mice (8-week-old) were arbitrarily separated into four groups (n = 8). The control group mice were injected with the control solvent intraperitoneally daily for 10 weeks. The NSC group mice were intraperitoneally injected with 1 mg/kg NSC319726 daily for 10 weeks. For 10 weeks, the mice in the TTM/RA group received intraperitoneal injections of 1 mg/kg NSC319726 daily. In the final five weeks, the mice were administered intraperitoneal injections of either 5 mg/kg RA or 0.03 mg/mL of TTM in their drinking water. Samples were collected from all the mice for the follow-up analysis after euthanasia.

Sample collection and processing

Following tribromoethanol anesthesia, all of the mice were euthanized in accordance with the approved methodology of Jilin University's Experimental Animal Ethics Committee in order to collect samples. Cardiac blood sampling were performed after anesthesia. The mice were weighed weekly, and their testes were collected and weighed after euthanasia. The testis index was calculated as weight in grams per gram of body weight. The epididymis was suspended in PBS buffer under 37℃, and the sperm counts, and malformation degree were measured as described previously by Seed J et al. (1996). A part of the samples was prefixed in a 4% paraformaldehyde solution and used for histological/fluorescence analysis, while the remaining part was processed and used for molecular analysis.

Fertility

After the 5-week treatment, male and ten-week-old female mice (at a ratio of 1:3) in each group were mated for 2 weeks. The vaginal plugs were examined daily for the purpose of identifying timed pregnancies. The number of pregnant mice and suckling mice was recorded for each group, and the pregnancy rate was calculated.

Histopathological section and immunofluorescence analysis

The tissues of the testes and epididymis were immersed in paraffin, segregated, fixed in 4% paraformaldehyde, and stained with hematoxylin and eosin (HE). The tissue slices were first exposed to primary antibodies for immunofluorescence at 4°C for a whole night. Subsequently, the tissue sections were treated for 1 h at room temperature with secondary antibodies labeled with FITC. The slices were mounted in DAPI-containing media and examined under a fluorescence microscope. Images were quantified and analyzed using Image J.

Biochemical assays

The harvested testes were weighed and homogenized with PBS. After letting the whole blood samples sit at 37 °C for 30 min, they were centrifuged at 3000 rpm for 15 min to collect serum. Testosterone levels were quantified using an ELISA kit (Elabscience, E-OSEL-M0003, China) following the manufacturer's guidelines. The BCA kit assessed the total amount of protein in samples to quantify and normalize test findings. The retinol and retinoic acid levels were determined using their respective commercially available ELISA kits following the manufacturer's protocol (Cusabio, CSB-E07891m, Wuhan) (Sakashita et al. 2022).

Examining the integrity of the blood-testis barrier in vivo

Using biotin, the blood–testis barrier (BTB) integrity assay was conducted as previously reported (Huang et al. 2021; Jia et al. 2017). After the 5-week treatment, 50 μL EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific, Cat. 21,338) was injected into the testis interstitium of mice. The testes were extracted after 40 min in preparation for cryosection at -20 °C. After blocking the 10 µm sections of testis tissue with 5% bovine serum albumin, they were incubated for 2 h with Alexa Fluor 568-conjugated streptavidin (AAT Bioquest, Cat. 16,960). After mounting with a DAPI medium, the tissue sections were observed under a fluorescence microscope. Blood–testis barrier integrity was analyzed quantified by the mean fluorescence intensity in seminiferous tubule.

Copper ion level detection

Using a Copper Colorimetric Assay Kit (E-BC-K300-M/E-BC-K775-M, Elabscience) and the manufacturer's guidelines, the testes and cell copper ion levels were determined (Xie et al. 2022). After measuring the absorbance at 580 nm, the standard curve was used to determine the copper levels.

Transcriptomic analysis

Thermo Fisher, CA, USA's TRIzol reagent (15,596,018) was used to extract total RNA, and Dynabeads Oligo (dT) was used to purify the mRNAs (5 µg) from the extract. Subsequently, SuperScriptTM II Reverse Transcriptase (Invitrogen, cat. 1,896,649, USA) was used to split the mRNA into brief segments for reverse transcription into cDNA. Finally, the Illumina NovaseqTM 6000 platform (LC-Bio Technology CO., Ltd., Hangzhou, China) was utilized to conduct the 2 × 150 bp paired-end sequencing (PE150) in accordance with the guidelines provided by the manufacturer. The R programs DESeq2 and edgeR were used for the DEG analysis comparing the two groups. Differentially expressed genes (DEGs) were defined as those having an absolute fold change of ≥ 2 and a P-value of < 0.05. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and Gene Ontology (GO) functions were examined for enrichment.

Metabolomic analysis

The metabolites were identified by profiling the extraction supernatants using liquid chromatography-mass spectrometry (LC–MS) after they were extracted with 80% methanol buffer. A Q-Exactive high-resolution tandem mass spectrometer (Thermo Scientific), which functioned in both positive and negative ion modes, was used to identify the metabolites that eluted from the column. XCMS software was used to process the MS data. The mass-to-charge ratio (m/z) and specific retention time (RT) of each metabolite were used to identify it. The KEGG database was utilized to annotate the metabolites through a comparison between the precise molecular mass data (m/z) of the samples and the information contained in the database. The student t-tests were applied to identify variations in metabolite levels between the two groups. Multiple tests were accounted for in the P-value using the Benjamini–Hochberg false discovery rate (FDR) method.

Real-time quantitative PCR

Total RNA from testicles was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's guidelines. Using an All-in-One 5X RT MasterMix Kit (Aibimeng Biotechnology Co., Ltd, China), 1 μg of total RNA was converted into complementary DNA (cDNA). Gene expression was detected with SYBR Green and evaluated quantitatively using the 2−ΔΔCT technique. PPIA was utilized as an internal reference (Gong et al. 2014). All experiments were replicated three times independently.

The following primer sequences were used:

Mus-CYP17A1;

F: CATCTCATTACACCCACACCC,

R: CACATCAAAGTCAAACCTCTGC.

Mus-ZO-1;

F: GGGGCCTACACTGATCAAGA,

R: TGGAGATGAGGCTTCTGCTT

Mus- Vinculin;

F: TGGTCTAGCAAGGGCAATGA

R: CTCGTCACCTCATCAGAGGC

Mus-β-catenin;

F: CAGATCCCATCCACGCAGTT

R: ATTGCACGTGTGGCAAGTTC.

Western blotting

Using RIPA lysis buffer combined with proteinase inhibitor and phosphatase inhibitor from Solarbio Life Sciences, the protein was extracted from testicular tissue. Protein samples were separated on a 10% SDS-PAGE gel, and the amount of protein was quantified using Beyotime Biotechnology's BCA Protein Assay Kit. After the proteins on the gel were separated, they were moved to a PVDF membrane, blocked for an hour at room temperature using 5% milk in TBST, and then incubated with primary antibodies for an additional night at 4 °C. After that, the membrane was treated for 1 h at room temperature with the secondary antibody, goat anti-mouse/rabbit-IgG (Bioworld, BS12478/BS13278, 1:5000 dilution), coupled with horseradish peroxidase (HRP). Shanghai Tanon Technology's Tanon-5200 fully automated digital gel imaging analysis equipment was used to detect the protein bands by enhanced chemiluminescence (ECL). Subsequently, the bands were examined using ImageJ software.

Cell culture and cell viability assay

We obtained the cell lines utilized in this investigation from the laboratory cell bank. The media used to cultivate TOV112D cells was M199:MCDB105 (1:1) supplemented with 15% FBS. HCT116 cells were cultured in 10% FBS-containing McCoy's 5A medium. A 1 M concentration of NSC319726 was applied to the cells. The viability of the cells was assessed utilizing the Cell Counting Kit-8 (CCK-8; Dojindo). The cells were dispersed into 96-well plates, and retinoic acid, or NSC319726, was applied to each well. The cell viability was determined following the manufacturer's guidelines by calculating absorbance at 450 nm.

Statistical analyses

Every experiment was conducted at least three times. The two-tailed Student's t-test was utilized to assess the statistical differences between the two groups. On the other hand, for multigroup comparisons, one-way analysis of variance (ANOVA) with a post-test was utilized to investigate differences between more than two groups (such as Tukey or Duncan tests).

The P-values < 0.05, < 0.01, < 0.001 indicated statistical significance, while ns indicated no significance.