Ethical statement

The animal experiments were approved by Animal Ethics Committee of Jiangnan University (JN No: 20210530c0601230[153]) and were carried out the Guide for Care and Use of Laboratory Animals of the School of Medicine of Jiangnan University.

Reagents

Minimum Essential Medium α (αMEM; Thermo Fisher Scientific, 12561056), Dulbecco’s modified Eagle medium/nutrient mixture F-12 (DMEM/F12; Thermo Fisher Scientific, 11330032), Fetal bovine serum (VivaCell, Shanghai, China, C04001), rosiglitazone (MedChemExpress, HY-17386), L755507 (MedChemExpress, HY-19334), Quizartinib (MedChemExpress, HY-13001), Barasertib (MedChemExpress, HY-10126), Telaglenastat (MedChemExpress, HY-12248), E6446 (MedChemExpress, HY-12756A), trypsin (Sangon Biotech, A100458), cell culture plate (NEST Biotechnology, 703001), cell culture dish (NEST Biotechnology, 704001), Oil Red O (Sangon Biotech, A600395), jetPRIME transfection reagent (Polyplus-transfection, 114–15), MolPure® Endo-free Plasmid Maxi Kit (Yeasen Biotechnology, 19021ES70), Hieff UNICON qPCR SYBR green master mix (Yeasen Biotechnology, 11198ES), polyvinylidene fluoride (PVDF) membranes (Millipore, ISEQ00010), HiScript III first-strand cDNA synthesis kit (Vazyme Biotech, R312-02), second-strand cDNA synthesis kit (Beyotime Biotechnology, D7172), ITS Media Supplement (Beyotime Biotechnology, C0341), radioimmunoprecipitation assay buffer (Beyotime Biotechnology, P0013B), FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme Biotech, RC112), Enhanced chemiluminescent reagent (ECL) (Millipore, WBKLS0500), HiFi PCR mix for next-generation sequencing (NGS) (CWBIO, CW2648), anti-β-actin (ABclonal, AC026), anti-SCD1 (ABclonal, A16429), HRP goat anti-rabbit IgG (ABclonal, AS014).

Experimental animals

Male C57BL/6J mice (8 weeks old, weighing 21 ± 2 g) were purchased from GemPharmatech Co., Ltd. (Nanjing, China), and housed at room temperature, 12-h light–dark cycle, with free access to food and water. The mice were divided into 3 experimental groups: normal control diet group (NCD; chow diet, 10% of calories derived from fat), high-fat diet (HFD, 60% of calories derived from fat, Research Diets, Beijing, China; D12451) + Vehicle group, and HFD + E6446 group. After 12 weeks, mice were three times in a week oral gavage with Vehicle or 20 mg/kg E6446 (MCE, China) for 6 weeks. The body weight was measured weekly during oral gavage experimental phases. Mice were sacrificed through isoflurane inhalation, and then blood, adipose, and liver samples were collected for further analysis.

Cell culture

Mouse OP9 and mouse AML12 cell were purchased from China Center for Type Culture Collection (Wuhan, China). Mouse OP9 cells were cultured in MEM supplemented with 5% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37 °C and 5% CO2. Mouse AML12 cells were cultured in Dulbecco’s modified Eagle medium (DMEM)/nutrient mixture F-12 supplemented with 5% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37 °C and 5% CO2. The medium was replaced every 3 days if not otherwise stated. To induce adipogenic differentiation, 100% confluent OP9 preadipocytes were stimulated with 1 μM rosiglitazone in DMEM containing 5% FBS for 15 days [9, 10, 18]. Adipogenic differentiation was induced by 1 μM rosiglitazone in DMEM containing 5% FBS with or without 10 μM E6446 for 15 days when OP9 cells grown to 90% confluence. To establish hepatic steatosis model, mouse AML12 cells were stimulated with palmitic acid (PA; 0.125 mM) and oleic acid (OA; 0.25 mM) with or without 10 μM E6446 at the indicated concentrations for 48 h.

Small interfering RNA (siRNA) transfection or plasmid transfection

Cells were grown to 50–70% confluence and then transfected with 50 nM siRNA or negative control (NC) siRNA 50 nM using jetPRIME transfection reagent according to the manufacturer’s protocol. The siRNA sequences were mouse ATF3: CAGAAUAAACACCUCUGCCAU; mouse SCD1: AGUUUCUAAGGCUACUGUCUUTT. Universal negative control siRNA (GenePharma, A06001) was used as a control. pcDNA3.1-SCD1 was used for SCD1 over-expression in OP9 and AML12 cells, and the pcDNA3.1 empty vector was used as a control.

Virtual screening based on the structure using libdock

The X-ray crystal structure of SCD1 [Protein Data Bank (PDB) code 4ZYO] was used for the docking studies. The small molecule database L3400, which contained 4121 molecules, used as the screening library. The LibDock module of Discovery Studio 2018 was used to virtual screening. LibDock is a rigid-based docking module. The active sites of SCD1 were defined using the PDB site records. CHARMM force field and the Smart Minimizer algorithm were performed for ligand minimization. All the docked poses were ranked and grouped, and all compounds were ranked according to the LibDock score.

Metabolic analysis

Total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-c), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels in mice serum or cells were measured using commercial kits (Nanjing Jiancheng, China). The liver tissues were homogenized in precooled absolute ethanol lysate (1:9, w/v), then supernatant was taken for later analysis. Liver TC, TG, and LDL-c were analyzed using enzyme kits (Nanjing Jiancheng, China) according to the manufacturer’s instructions. For liver ALT and AST, the precooled saline solution (1:9, w/v) was used to homogenize mice liver tissues, then supernatant was analyzed using enzyme kits (Nanjing Jiancheng, China) according to the manufacturer’s instructions. For glucose tolerance testing (GTT), the mice were fasted for 6 h, and blood glucose level was measured before intraperitoneal injection of 1 g/kg glucose and then 15, 30, 60, 90, 120, or 150 min after injection. Area under the curve (AUC) was used to quantify the GTT results.

Lactate dehydrogenase (LDH) assay

AML12 or OP9 cells were seeded into 96-well plates and treated with 0, 10, 2, 0.4, 0.08 μM E6446 or A939572 with palmitic acid (PA; 0.125 mM) and oleic acid (OA; 0.25 mM) for 48 h. LDH levels in AML12 cells were measured using commercial kits (Nanjing Jiancheng, China).

CCK8 assay

AML12 or OP9 cells were seeded into 96-well plates and treated with 0, 10, 2, 0.4, 0.08 μM E6446 or A939572 with palmitic acid (PA; 0.125 mM) and oleic acid (OA; 0.25 mM) for 48 h. Next, 10 μL of CCK8 solution was added and incubated at 37 °C with 5% CO2 for 2 h. The absorbance at 450 nm was measured using a microplate reader.

Fatty acid methyl ester (FAME) analysis

FAME analysis was performed according to our previous study [9]. Briefly, cell lysates were quantified on a Q Exactive™ GC Orbitrap™ GC–MS/MS (Thermo Scientific) with a Rtx-Wax column (Restek, 12423). Injection port and detector temperatures were maintained at 280 °C. Initially, the column temperature was held at 40 °C for 5 min, then was increased at a rate of 40 °C/min to 120 °C for 5 min, then was raised to 190 °C at 10 °C/min for 5 min, and finally to 230 °C at 5 °C/min for 7 min; the total time spent for all fatty acid peaks was approximately 34 min. In order to identify peak locations, retention times were compared with those of known standards (Sigma Chemical). A reference standard (C15:0) was used to quantify the individual fatty acids. Subsequently, the sample was normalized to total cellular protein.

cDNA library construction and RNA sequencing (RNA-seq)

RNA-seq was performed according to our previous study [18]. For the purpose of constructing the sequencing libraries, a total of 1 μg RNA was obtained from each sample. We converted the RNA into double-stranded cDNA in accordance with the reverse transcription kit instructions, and then we digested and labeled the double-stranded cDNA using Tn5 transposase. The final step was enrichment PCR using the HiFi PCR Mix for NGS. An Agilent 2100 Bioanalyzer was used to quantify the libraries. Using an Illumina NovaSeq instrument, paired-end sequencing of the library was conducted (sequencing was performed by GENEWIZ Biotech). A STAR program was used to map the reads to the mouse genome (http://code.google.com/p/rna-star/). Genes that showed a 1.5-fold change in expression (P < 0.05) were considered significantly differentially expressed. Differentially expressed genes (DEGs) were enriched by Gene Ontology (GO) using Metascape (http://metascape.org) [19].

Western blot

RIPA buffer was used to lysed the total protein from cells, and western blotting was performed according to the procedures previously described. Briefly, protein samples (50 μg) were separated by 10% sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis and electrically transferred to PVDF membranes. The membrane was blocked with 5% defatted milk for 1 h, and then were washed 3 times with TBST. The membranes incubated with primary antibodies against SCD1 and β-actin at 4 °C overnight. Primary antibodies were detected with anti-rabbit IgG conjugated to horseradish peroxidase (HRP). Immunodetection was visualized using an enhanced chemiluminescent (ECL) reagent (Biotanon Biotechnology, Shanghai, China). Quantification of band intensity was performed using ImageJ software (version 1.53; National Institutes of Health).

RNA extraction and RT–qPCR assay

Total RNA was extracted as previously described [20]. 1 μg RNA reverse transcribed into cDNA using HiScript III first-strand cDNA synthesis kit. RT–qPCR was performed using Hieff UNICON qPCR SYBR Green Master Mix and Roche LightCycler 480 PCR System (Roche Applied Science, Basel, Switzerland). Relative gene expression was determined using the 2 − ΔΔ method. The primers are described in Table 1.

Table 1 Primers for RT–qPCROil Red O staining

After washing with phosphate-buffered saline (PBS), the cells or liver sections were fixed in 4% paraformaldehyde for 30 min, followed by three washes with PBS. Cells or liver sections were stained for 15 min with 60% saturated Oil Red O. Finally, 60% isopropanol was used to wash the cells or liver sections, followed by hematoxylin counterstaining. The histological images were acquired with a light microscope (3D Histech, Hungary).

Histological analysis of liver

Haematoxylin and eosin (H&E) staining of liver tissues was performed as previously reported [21], the histological images were acquired with a light microscope (3D Histech, Hungary).

Surface plasmon resonance (SPR) analysis

SPR experiments were performed using Biacore X100 (Cytiva, United States). HBS-EP buffer (Cytiva, USA) was used as the working buffer, and the SCD1 recombinant protein was diluted to a final concentration of 20 μg/mL. A mixture of NHS and EDC (1:1, v/v) was injected into the instrument to activate the CM5 sensor. Then, the 20 μg/mL SCD1 recombinant protein was injected to immobilize it onto the CM5 chip through amino coupling. Subsequently, a 1 M ethanolamine hydrochloride (pH 8.5) was injected for 7 min to block and activate the chip surface. E6446 (100, 50, 25, 12.5, 6.25, 3.125 μmol/L) and A939572 (100, 50, 25, 12.5, 6.25, 3.125 μmol/L) were then injected using HBS-EP buffer and passed over the immobilized SCD1 chip sensor surface. The binding kinetics of E6446 and SCD1 were calculated based on the fitted data from the analysis software, with time as the abscissa and response values as the ordinate.

Statistical analysis

The data are presented as the mean ± standard error of the mean (SEM). All experiments were repeated at least three times. GraphPad Prism 8.0, SPSS 19.0, and R 3.6.0 were used for data analyses. Student’s t-tests and one-way analysis of variance were used to analyze the differences between the groups. P < 0.05 was regarded as statistically significant.