Cell culture and reagents

All cancer cell lines were obtained from the American Type Culture Collection. All cell lines were free from mycoplasma contamination (tested by PCR). Cells were cultured in DMEM with 10% fetal bovine serum (Corning) in a 5% CO2 air atmosphere. DMEM without glucose was purchased from Life Technologies (11966-025, Thermo Fisher Scientific, Waltham, Massachusetts, USA). Nucleosides, nucleotides, guanine were purchased from Merck Sigma‒Aldrich. PNP assay kit (ab204706) was purchased from Abcam. GLUT inhibitor KL-11743 was purchased form MCE. D5P, FDP and 6PG were obtained from Shanghai YuanYe Bio-Technology. The cell death detection kit was purchased from Beyotime (Shanghai, China).

Treatments

For glucose deprivation, cells seeded in 12-well plates or 6 cm dishes were cultured to 90% confluence. After washing with PBS, conditioned medium prewarmed to 37 °C was gently added to each sample, and the cells were cultured for the indicated times. For the recovery experiment, adenosine, guanosine, D5P, guanine or other nucleosides/nucleotides were supplemented in glucose-free medium before being added to the samples, and then the cells were cultured for the indicated times.

Mice, histology and immunofluorescence

All mice were maintained in specific-pathogen-free (SPF) facility and were performed in compliance with the guide for the care and use of laboratory animals and were approved by the institutional biomedical research ethics committee of the Institutional Animal Care and Use Committee of Zhengzhou University. APCmin/+ mice (Strain NO. T001457) were purchased from GemPharmatech (Nanjing, China). Mice were sacrificed at the indicated time points, and colons were collected immediately after sacrifice, and prepared for experiments. For Histology and Immunofluorescence experiments, tissues were fixed overnight in 4% paraformaldehyde, prepared using the Swiss roll technique, embedded in paraffin, and cut into 7-μm sections.

Organoid experiment

In brief, the tissue from colorectal cancer patient was washed by 1 × PBS and digested by collagenase I. Then a 100 µL mixture of Matrigel (BD Biosciences) and complete growth medium (2:1) was added with a pellet of 500–1000 crypts. After polymerization, 100 µL of complete growth medium [Advanced DMEM/F12 (Invitrogen) containing growth factors: 50 ng/mL EGF, 500 ng/mL R-spondin1, and 100 ng/mL Noggin (PeproTech)] was added and refreshed every 2–3 days. On the fifth day, 6 mM D5P and 3 μM KL-11743 was added. After a 60 h culture, the organoids were photographed to record the volume and measured by MD50 software from Mshot.

Stable cell line generation

The short hairpin RNA (shRNA) used in this paper was constructed with the pLKO.1 system, and the lentiviral plasmid overexpressing YAP-5SA was constructed with the pLVX-IRES-Puro system. Cell lines with specific gene silencing or overexpression were generated as previously described. In brief, HEK293T cells were transfected with either the pLKO.1 or pLV plasmid, together with Δ8.9 and the VSVg third-generation lentiviral packaging system using Lipofectamine 2000 reagent (Life Technologies) according to the manufacturer’s instructions. After transfection, lentivirus particles in the medium were collected every twenty-four hours, and after three collections, the medium was filtered, and the target cell lines were infected. At 48 h after infection, 2 μg/ml puromycin was added to obtain stable cell lines with successful transduction. The sequences of shRNAs used in this study: shYAP-1: CAGGTGATACTATCAACCAAA; shYAP-2: GACCAATAGCTCAGATCCTTT; shPNP: GCTCTCAGTACCTGGAAACAA; shPGM2: CGACTAATAGCAGAAGGTAAT; shMYH9: GACAGCAATCTGTACCGCATT; shMYH10: GCTCGGATGAAGCAGCTTAAA.

Western blotting

Proteins were separated by FuturePAGE™ surePAGE™ and SDS‒PAGE and transferred to PVDF or nitrocellulose membranes with a wet transfer system. Membranes were blocked with TBST containing 5% milk or 5% BSA before overnight incubation with primary antibodies. After incubation with secondary horseradish peroxidase-coupled antibodies, signals were detected using ECL-based chemiluminescence. The primary antibodies and concentrations used for western blotting were as follows: YAP (1:1000, CST, 14074), P-YAP (1:1000, CST, 13008), LATS1 (1:1000, CST, 3477), MYH9 (1:2000, CST, 3403), P-JNK (1:1000, CST, 9255), PNP (1:100, Santa Cruz, sc-365551), LC3A/B (1:1000, CST, 4108), P21(1:1000, CST, 2947), PARP (1:1000, CST, 9542), c-PARP (1:1000, CST, 5625), G3BP1 (1:1000, CST, 61559), GAPDH (1:10000, Proteintech, 66004), actin (1:10000, Proteintech, 66009), and tubulin (1:10000, Proteintech, 66031). Phos-tag acrylamide was purchased from Wako. Phos-tag western blotting was performed in gels containing 8% acrylamide, 50 μM MnCl2 and 25 μM Phos-tag and was followed by immunoblotting.

Protein isolation

Most proteins were collected with 1 × loading buffer. For supernatant and pellet separation, collected cells were lysed with 160 μl of Pierce™ IP Lysis Buffer (#87787 Thermo Fisher Scientific) supplemented with cOmplete protease inhibitor (Roche) and PhosSTOP phosphatase inhibitor (Roche). Then, 80 μl of cell lysate was transferred to a new tube with 80 μl of 3 × loading buffer, and incubated on ice for 15 min. After incubation, the tubes were centrifuged at 13,000 rpm for 15 min, 80 μl of supernatant was transferred to a new tube with 40 μl of 3 × loading buffer, and the insoluble pellet was resuspended in 120 μl of 1 × loading buffer.

Immunoprecipitation (IP) and Mass Spectrometry (MS)

For IP assays, cells were lysed and washed with Pierce™ IP Lysis Buffer (#87787, Thermo Fisher Scientific) supplemented with cOmplete protease inhibitor (Roche) and PhosSTOP phosphatase inhibitor (Roche). Cell lysates were incubated overnight at 4 °C with the indicated primary antibody and Pierce™ Protein A/G Magnetic Beads (#88802, Thermo Fisher Scientific). Beads were washed 4 times with IP lysis buffer and boiled in SDS-loading buffer for 10 min at 95 °C. Samples were run on a SurePAGE™ gel (M00657, Genscript.) and stained with Coomassie brilliant blue staining solution to identify the differential bands. Then, the bands were excised and sent out for MS identification (Biotree, Shanghai, China).

RNA isolation and RT‒qPCR

RNA was isolated using TRIzol followed by RQ1 RNase-free DNase Set treatment (Promega) according to the manufacturer’s instructions. First-strand cDNA was synthesized using Superscript II (Takara), and 1 μg of total RNA was used in each cDNA synthesis reaction. TB Green Master Mix reagents (Takara) and primer mixtures were used for real-time PCR. Student's t test was used for statistical analysis, and a P value less than 0.05 was considered significant. Primers: CTGF: CAGCATGGACGTTCGTCTG and AACCACGGTTTGGTCCTTGG; CYR61: CTCGCCTTAGTCGTCACCC and CGCCGAAGTTGCATTCCAG; THBS1: GCCATCCGCACTAACTACATT and TCCGTTGTGATAGCATAGGGG; NUAK2: GATGCACATACGGAGGGAGAT and GCTGGCATACTCCATGACGAT; PGM2: GAGGCAGTGAAACGACTAATAGC and CTGTCCCAAACTCCATTCGGG; MYH9: CCTCAAGGAGCGTTACTACTCA and CTGTAGGCGGTGTCTGTGAT; MYH10: TGGTTTTGAGGCAGCTAGTATCA and AGTCCTGAATAGTAGCGATCCTT.

RNA-Seq

Samples were subjected to Illumina NovaSeq 6000 performed by Mingma Technologies. mRNA was extracted from total RNA using magnetic beads with oligo-dT and then fragmented randomly. First- and second-strand cDNA were then synthesized using reverse transcriptase. The reverse transcription product was subjected to terminal repair, followed by the addition of an A base at the 3' end. Subsequently, the fragments were ligated with an Illumina universal adapter. After PCR amplification, the ligation products were purified to remove the incompletely ligated fragment and the self-ligated adapter. Library sizes were determined using an Agilent 2100 Bioanalyzer, and library concentrations were ascertained using Qubit 2.0. DNA sequencing was performed according to Illumina's standard protocol. edgeR used the overdispersed Poisson model and empirical Bayes model to estimate the dispersion of all gene expression levels. In this project, raw read counts of gene expression were applied to estimate the differentiation between paired samples or groups by using the edgeR package in R. Genes with CPM and TMM values greater than 1 in at least one sample were selected. The criteria for significantly differentially expressed genes were P-adj < 0.05 and |FC|> = 2. The Ensembl, GO, and KEGG databases were used to annotate differentially expressed genes to illustrate the biological processes related to these genes. Enrichment analysis was based on hypergeometric distribution statistics to determine whether a group of genes was significantly enriched in a certain function or KEGG pathway. In this project, a set of significantly upregulated or downregulated genes was used as the input to examine the significance of gene enrichment in a GO function or KEGG pathway by using the GOstat package in R. The criteria was P value < 0.01.

Cell death analysis

After the indicated treatment, cells were digested and collected. After centrifugation, the medium was removed, and the cells were resuspended in the corresponding staining buffer. After incubation, the samples were analyzed by Attune NxT.

PNP activity assay

Cells seeded in 12-well plates were treated as indicated, and then harvested to detect PNP activity using PNP activity assay kit (ab204706, abcam). Briefly, to prepare cell extract, add 150–300 μL of cold 1 × PNP Assay Buffer containing protease inhibitor cocktail to 1–5×106 fresh cells and pipette several times to disrupt the cells. Transfer cell homogenate including cell debris to a cold microfuge tube and agitate on a rotary shaker at 4 °C for at least 15 min. Centrifuge cell homogenate at 10,000 g, 4 °C for 15 min. Transfer the clarified supernatant to a fresh pre-chilled tube and store on ice. Use lysates immediately to examine PNP activity. The fluorescent product was measured at ex = 535 nm/em = 587 nm in a kinetic mode. And calculate the activity of PNP using the formula provided in the manual.

Immunofluorescence

Cells grown on coverslips were fixed with 4% paraformaldehyde (DF0135, Leagene, Beijing, China) for 15 min at RT, washed for three times with 1 × PBS, blocked in blocking buffer (5% goat serum, 0.3% Triton X-100 in 1 × PBS) for at least one hour at RT, and incubated with primary antibodies diluted in blocking buffer for 2 h at RT or 4 °C overnight. After three washes in 1 × PBS, the samples were treated with secondary antibodies tagged with Alexa Fluor 647 (4414S, CST) for one hour at RT in the dark. Cells were washed twice in 1 × PBS and then stained with DAPI (D9542, Sigma-Aldrich). Glass slides were mounted in ProLong™ Diamond Antifade Mountant (P36965, Invitrogen). Images were acquired using a Leica THUNDER microscope and processed by LAS X. Actin was stained by CellMask™ Green Actin Tracking Stain.

Untargeted metabolomics analysis

Metabolite extraction: Cells were grown in individual 60 mm plates with 6–10 biological replicates per sample group, and each sample had an equivalent amount of protein (~ 10 mg) or number of cells (1 × 107 or 1 × 106). Samples were collected in an EP tube, and 1000 μL of extract solution (methanol: acetonitrile: water = 2:2:1) was added. Then, the samples were homogenized at 60 Hz for 3 min at − 20 °C. Then, the samples were incubated for 1 h at − 20 °C and centrifuged at 12,000 rpm (RCF = 13,800 × g, R = 8.6 cm) for 15 min at 4 °C. The resulting supernatant was transferred to a fresh glass vial for analysis. LC‒MS/MS Analysis: LC‒MS/MS analyzes were performed using an UHPLC system (ExionLC AD, AB SCIEX, USA) with an ACQUITY UPLC BEH Amide column (2.1 mm × 100 mm, 1.7 μm, Waters) coupled to a quadruple time-of-flight mass spectrometer (TripleTOF 5600+, AB SCIEX, USA). The column temperature was maintained at 25 °C. Mobile phase A was 25 mM ammonium hydroxide (NH4OH) + 25 mM ammonium acetate (NH4OAc) in water, and mobile phase B was ACN for both the positive (ESI+) and negative (ESI−) modes. The elution flow rate was 0.3 mL/min, and the gradient was as follows: 0–1 min: 95% B, 1–14 min: 95% B to 65% B, 14–16 min: 65% B to 40% B, 16–18 min: 40% B, 18–18.1 min: 40% B to 95% B, and 18.1–23 min: 95% B. The injection volume was 2 μL. All samples were injected randomly during data acquisition, which occurred in information-dependent acquisition (IDA) mode. The source parameters were set as follows: ion source gas 1 (GAS1), 50 psi; ion source gas 2 (GAS2), 50 psi; curtain gas (CUR), 35 psi; temperature (TEM), 500 °C; declustering potential (DP), 80 V or − 80 V in positive or negative modes, respectively; and ion spray voltage floating (ISVF), 5500 or − 4500 V in positive or negative modes, respectively. The TOF MS scan parameters were set as follows: mass range, 60–1200 Da; accumulation time, 200 ms; and dynamic background subtraction, on. The product ion scan parameters were set as follows: mass range, 25–1200 Da; accumulation time, 50 ms; collision energy, 35 or − 35 V in positive or negative modes, respectively; collision energy spread, 15; resolution, UNIT; charge state, 1 to 1; intensity, 100 cps; exclude isotopes within 4 Da; mass tolerance, 10 ppm; maximum number of candidate ions to monitor per cycle, 10; and exclude former target ions for 4 s after two occurrences. Data preprocessing and annotation for Fig. 2A, B and F: The raw data were processed with XCMSPlus v3.6.3 for peak detection, extraction, alignment, integration, and annotation. The centWave algorithm was used for peak picking with a resolution of 15 ppm, minimum and maximum chromatographic peak widths from 5 to 20 s, and a signal-to-noise ratio of 6. The Obiwarp algorithm was applied for retention time correction.

Targeted metabolomics analysis (600MRM)

We performed 600MRM analysis (Biotree, Shanghai, China) in Figs. 2C and 5A. After the addition of 200 μL of H2O, the samples were vortexed for 30 s. The samples were precooled in dry ice, underwent three freeze‒thaw cycles in liquid nitrogen, and vortexed for 30 s. After the addition of 800 μL of acetonitrile-methanol (1:1, v/v precooled at − 40 °C), the samples were vortexed for 30 s and sonicated for 15 min in an ice water bath. This was followed by incubation at − 40 °C for 2 h and centrifugation at 12,000 rpm (RCF = 13,800 × g, R = 8.6 cm) and 4 °C for 15 min. An 800 μL aliquot of the supernatant of each sample was transferred to a new Eppendorf tube and dried with a centrifugal concentrator. Then, 160 μL of 60% acetonitrile was added to the Eppendorf tube to reconstitute the dried sample, and the Eppendorf tube was vortexed until the powder was dissolved, followed by centrifugation at 12,000 rpm and 4 °C for 15 min. Finally, 100 μL of the supernatant of each sample was transferred to a glass vial for LC‒MS/MS analysis. A mixture of standard metabolites was prepared as a QC sample. Standard Solution Preparation: Different volumes of each standard stock solution were transferred to a flask to create a mixed working standard solution. A series of calibration standard solutions were then prepared by stepwise dilution of this mixed standard solution (containing an isotopically labelled internal standard mixture that had concentrations identical to those in the samples). The criteria for significantly altered metabolites were P < 0.05 and VIP (Variable Importance in the Projection) > 1. The mass spectrum data acquisition and quantitative analysis of metabolites were completed by SCIEX Analyst Work Station Software (1.7.3) and BI0TREEBioBud (2.0.3). The enrichment analysis was performed using R (KEGGgraph) Software (1.46.0, 2.4-2).

Statistical analysis

All experiments in vitro were done independently with at least three biological replicates. The data presentation form and statistical analyses are given in the corresponding figure legends. Data analyses were carried out with GraphPad Prism (v9.0, La Jolla, USA). P values < 0.05 were considered as statistically significant.