Wistar rats, 10–15 weeks old, were sacrificed by an intraperitoneal overdose of ketamine and xylazine, and the inferior vena cava was immediately cut. Pulmonary perfusion was performed through the right ventricle with warm 1X phosphate-buffered saline (PBS) to remove blood from the lungs. The trachea was then intubated, and low gelling 1.5% agarose (Sigma-Aldrich) in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12, Thermo Fisher Scientific) was slowly injected into the lungs and left to fully solidify. The whole lungs were then cut out, divided into individual lobes, and cut into 500 µm slices with VT1000s Vibratome (Leica) equipped with the cooling system. Lung tissues were sliced at a frequency of 100 Hz and amplitude of 1.0 mm. PCLS were cut from slices with 4-mm diameter biopsy punchers and transferred to DMEM/F-12 medium supplemented with penicillin (100 U/ml), streptomycin (100 µg/ml), and 0.1% fetal bovine serum (FBS) and cultured at 37 °C, 5% CO2 in a humidified atmosphere. PCLS were cultured in a 96-well plate (one PLCS per well submerged in 200 µl of media) for 7 days and the culture medium was changed every 24 h.

To induce allergic inflammation, PCLS (n = 3) were treated with 80 ng/ml of rat IL-13 (PeproTech) for 7 days with a fresh medium replacement (supplemented with the same concentration of IL-13) every other day. PCLS (n = 3) treated with 0.9% saline in the same way was used as a control in this experiment. PCLS (n = 3), treated with 0.9% saline in the same manner, were used as a control in this experiment.

After that, PCLS were snap-frozen in liquid nitrogen and stored at −80 °C (single PCLS per Eppendorf tube without any cryoprotectant) for RNA/protein isolation. Culture medium from each well was transferred to Eppendorf tube and stored at −80 °C for lactate dehydrogenase (LDH).

LDH release to PCLS culture media was measured with Cytotoxicity Detection Kit (Sigma-Aldrich) according to the manufacturer instructions. Briefly, 100 μl of PCLS culture medium or cell-free medium (background control) was gently transferred to a 96-well flat-bottom microplate and mixed with 100 μl of freshly prepared reaction mixture, followed by incubation for 30 min at room temperature (21 ± 1 °C). The optical density was measured at 490 nm with Asys UVM 340 microplate reader (Biochrom). The background control (mean OD ~ 0.082) was subtracted from all optical density data obtained from the PCLS media.

PCLS (1 PCLS per isolation) were lysed in an appropriate lysis buffer using an ultrasonic tissue sonicator (Sonoplus HD 3200, Bandelin). To homogenize PCLS, we used 4 cycles of 5 pulses at 10% of sonicator efficiency. Each miRNA/RNA isolation was performed in 3 technical replicates. We used 200 μl of QIAzol Lysis Reagent (Qiagen) for the following protocols: QIAZ-1 (standard QIAzol protocol), QIAZ-2, and QIAZ-3, and 100 μl for QIAZ-4. Samples were incubated for 5 min at room temperature (21 ± 1 °C) to fully dissociate the nucleoprotein complexes, followed by mixing with chloroform (0.2 ml of chloroform per 1 ml of QIAzol Lysis Reagent). Samples were then incubated for 3 min at room temperature and centrifuged for 15 min at 12 000 × g at 4 °C. The aqueous phase was carefully transferred to a new tube and supplemented with 20 μg (in a volume of 1 μl) of UltraPure RNA-free glycogen (Thermo Fisher Scientific). The interphase and the phenol–chloroform phase were saved for subsequent protein isolation. The aqueous phases from QIAZ-2, QIAZ-3, and QIAZ-4 protocols were additionally supplemented with 5 M sodium chloride (NaCl) to a final concentration of 1.2 M. The aqueous phase from the QIAZ-1 protocol was not supplemented with NaCl. RNA was precipitated with isopropanol (0.5 ml of isopropanol per 1 ml of QIAzol Lysis Reagent) for 10 min at room temperature (QIAZ-1), 2 h at -20 °C (QIAZ-2) or 4 °C (QIAZ-3 and QIAZ-4). Samples were then centrifuged for 10 min at 12000 × g at 4 °C to precipitate RNA, followed by washing the pellet three times with 75% ethanol. RNA pellet was air dried for 5–10 min, dissolved in 15 μl of RNase-free water, and incubated in a heat block set at 55 °C for 10 min.

For GHCL-1 and GHCL-2 protocols, PCLS were lysed in 200 μl of guanidinium hydrochloride (GHCL) extraction buffer (0.1 M β-mercaptoethanol, 6.5 M guanidinium hydrochloride, 100 mM Tris–HCl pH 7.4, 0.1 M sodium acetate pH 5.5). To precipitate agarose, GHCL buffer was supplemented with potassium acetate to a final concentration of 0.2 M, incubated for 10 min at room temperature, and centrifuged for 15 min at 12 000 × g at 4 °C. The supernatant was transferred to a new tube, mixed with 100 μl of QIAzol Lysis Reagent, and incubated for 5 min at room temperature. Each tube was then shaken with 40 μl of chloroform and incubated for 3 min at room temperature. Samples were then centrifuged for 15 min at 12 000 × g at 4 °C, and the aqueous phase was transferred to a new tube, followed by supplementation with 20 μg of UltraPure RNA-free glycogen. Samples isolated with GHCL-2 were additionally supplemented with 5 M NaCl to a final concentration of 1.2 M. RNA was precipitated with isopropanol (0.5 ml of isopropanol per 1 ml of GHCL buffer) for 2 h at 4 °C and centrifuged (10 min at 12,000 × g at 4 °C). RNA pellets were washed three times with 75% ethanol and dissolved in RNase-free water, similar to QIAZ protocols. The overview of RNA isolation protocols is shown in Fig. 1. PCLS treated with IL-13 and 0.9% saline (control) were extracted with QIAZ-4 protocol. Lung tissues (~ 5 mg) were isolated with QIAZ-1 (100 µl of QIAzol Lysis Reagent) and QIAZ-4 protocol.

Schematic presentation of miRNA and RNA isolation protocols

Each protein isolation was performed in 3 technical replicates using phenol–chloroform phase collected during miRNA/RNA isolation. All samples were supplemented with 100% ethanol (0.3 ml of 100% ethanol per 1 ml of QIAzol Lysis Reagent), thoroughly mixed, and incubated at room temperature for 2–3 min. Samples were centrifuged for 5 min at 2,000 × g at 4 °C to precipitate DNA, and supernatants were transferred to new tubes. For QIAZ-P1 and QIAZ-P2 protein was precipitated with, respectively, isopropanol (1.5 ml of isopropanol per 1 ml of QIAzol Lysis Reagent) or acetone (3 volumes of acetone per 1 volume of phenol-ethanol supernatant) and incubated for 10 min at room temperature. For QIAZ-P3, QIAZ-P4, and QIAZ-P5 samples were supplemented with, respectively, 3, 5, and 7 volumes of acetone per 1 volume of phenol-ethanol supernatant and incubated for 3 h at −20 °C. All abovementioned samples were centrifuged for 10 min at 12 000 × g at 4 °C and washed three times with 0.3 M guanidine hydrochloride in 95% ethanol (2.0 ml of wash buffer per 1 ml of QIAzol Lysis Reagent) followed by a single wash with 2 ml of 100% ethanol. During each wash cycle, the protein pellets were stored in a washing solution for 20 min at room temperature and then centrifuged for 5 min at 7 500 × g at 4 °C. Protein pellets were air dried for 5–10 min, dissolved in 50 µl of 4 M Urea/1% SDS solution, and incubated in a heat block set at 50 °C for 10 min at the agitation rate of 500 rpm. Samples were centrifuged for 10 min at 10 000 × g at 8 °C, supernatants were transferred to new tubes and stored at -80 °C for further analysis.

For RIPA protocol, we used one PCLS in 50 μl of RIPA Lysis Buffer (Sigma-Aldrich) supplemented with cOmplete ULTRA Tablets (Sigma-Aldrich) protease inhibitor cocktail according to manufacturer instructions. PCLS were homogenized as in the miRNA/RNA isolation protocols with an ultrasonic sonicator. Lysates were centrifuged at 8 000 × g for 10 min at 4 °C to pellet the cell debris, and the remaining supernatants were stored at −80 °C.

For QIAZ-P6, back extraction buffer (4 M guanidine thiocyanate, 50 mM sodium citrate, and 1 M Tris pH 7.4) was vigorously mixed with the interphase-organic phase (0.5 ml of back extraction buffer per 1 ml of QIAzol Lysis Reagent) and incubated for 10 min at room temperature. Samples were then centrifuged at 12 000 × g for 15 min at 4 °C, and the upper phase (containing DNA) was discarded. The organic phase was supplemented with 5 volumes of acetone, mixed vigorously, and incubated at room temperature for 10 min. Protein pellet washing and solubilization were performed similarly to the QIAzol-based protocols. The overview of protein isolation protocols is shown in Fig. 2. PCLS treated with IL-13 and 0.9% saline (control) were extracted with QIAZ-P3 protocol. Lung tissues (~ 5 mg) were isolated with RIPA Lysis Reagent and QIAZ-P3 protocol.

Schematic presentation of protein isolation protocols

The RNA concentration and purity were determined by measuring absorbance with NanoDrop2000 (Thermo Fisher Scientific) spectrophotometer. We used Quantus Fluorometer (Promega) for fluorescent RNA, and miRNA quantification with, respectively, QuantiFluor RNA System (Promega) and Qubit microRNA Assay Kit (Thermo Fisher Scientific). RNA integrity number (RIN) was assessed using RNA ScreenTape System (Agilent) with Agilent 2200 TapeStation System (Agilent).

RNA and miRNA were converted to cDNA using, respectively, Reverse Transcription Kit (Promega) and TaqMan Advanced miRNA cDNA Synthesis Kit (Thermo Fisher Scientific). GAPDH and Exotoxin-1 expression was measured with SYBR Green MasterMix (Promega) using the comparative method (ΔΔCt) and the following primers: GAPDH forward 5’-AACTCCCTCAAGATTGTCAGCAA-3’ and GAPDH reverse 5’-GGCATGGACTGTGGTCATGA-3', Eotaxin-1 forward 5’- CTATTCCTGCTGCTCACGGC-3’ and Eotaxin-1 reverse 5’- CAGGAAGTTGGGATGGAACCTGG -3'. Rno-miR-223-3p was quantified with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan Advanced miRNA Assay (Thermo Fisher Scientific) as a hybridization probe (assay ID: rno481007_mir). We chose rno-miR-223-3p as in our previous study, this miRNA was expressed in rat lungs and its crucial role in the pathogenesis of human respiratory diseases [11]. Data acquisition was performed in ABIPrism 7900HT (Applied Biosystems) using SDS 2.4 software. Data analysis was performed using DataAssist v3.01.

Protein concentration was measured using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). For Western blot, we used 1.25 μg, 2.5 μg, 5 μg and 10 μg of total protein. Samples were mixed with Tris–Glycine SDS Sample Buffer (2X) (Thermo Fisher Scientific) and NuPAGE Sample Reducing Agent (10X) (Thermo Fisher Scientific) and heated at 85 °C for 2 min, followed by SDS-PAGE gel electrophoresis. For total protein normalization, the gel was stained with No-Stain Protein Labeling Reagent (Thermo Fisher Scientific) and visualized on a UV transilluminator (ChemiDoc Imaging System, Bio-Rad). Proteins were transferred to a nitrocellulose membrane with iBlot 2 Dry Blotting (Thermo Fisher Scientific) system using pre-programmed P0 method: 20 V for 1 min, 23 V for 4 min, 25 V for 2 min. The membrane was then blocked for 1 h in 5% BSA dissolved in phosphate-buffered saline containing 0.05% Tween-20 (PBST), followed by overnight incubation with rabbit monoclonal anti-FKBP51 (ab126715) primary antibody (1:1000) at 4 °C. We quantified FKBP51 as in our previous experiments, this protein was highly expressed in rat lungs (data not published). The membrane was washed three times for 10 min with PBST, followed by incubation with anti-rabbit IgG HRP-conjugated (HAF008) secondary antibody (1:1000) for 1 h at room temperature. The membrane was washed three times for 10 min with PBST, followed by protein band detection with ECL SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) in ChemiDoc Imaging System (Bio-Rad). The band and total protein intensities were measured in ImageJ version 1.54.

One-way ANOVA with Tukey HSD (Honestly Significant Difference) post-hoc test was used to calculate differences between groups. The normality of data distribution and variance homogeneity were assessed using Kolmogorov–Smirnov and Cochran's C test, respectively. Statistical analyses were performed in Statistca version 13, and graphs were plotted in GraphPad Prism version 9.0.