Isolation and identification of ADSCs

With approval from the Ethics Committee of the Second Xiangya Hospital of Central South University, adipose tissue was collected from the abdomen of ten Sprague-Dawley (SD) male rats (12 weeks old, 160–180 g). All rats were given isoflurane (0.41 mL/min at 4 L/min fresh gas flow, 2%) inhalation anesthesia before being put to death with a 1.5% sodium pentobarbital (dose: 200 mg/kg) intraperitoneal injection. Rats’ abdomens were dissected after a thorough sterilization, and the abdominal adipose tissue was removed. Blood vessels and fascia were adequately removed from rat adipose tissue. Adipose tissue that had been sheared was placed in a sterile centrifuge tube and then digested using the same volume of collagenase type I (0.25%, Solarbio, C8140). Once the digestion was finished, the adipose tissue switched the form of chyme, to which an equal volume of ADSCs complete medium was added to stop the process. ADSCs complete medium consisted of 90% dulbecco’s modified eagle medium (DMEM) (high glucose, Procell, PM150210), 9% special grade fetal bovine serum (FBS) (Procell, 164210-50), and 1% penicillin-streptomycin solution (Gibico, 15140122). Next, the adipose tissue was filtered through a sterile cell strainer, centrifuged (1000 rpm/min for 5 min), the supernatant was discarded to preserve the precipitates, and the cellular precipitates were resuspended using ADSCs complete medium. The cells were moved to a CO2 incubator for culture (37 °C, 5% CO2, saturated humidity) after digestion and centrifugation. Third-generation cells’ surface marker expression levels (CD29 (FITC anti-rat CD29 Antibody, BioLegend, 102205), CD44 (FITC anti-rat CD44 Antibody, BioLegend, 203906), CD73 (Anti-CD73/FITC antibody, Bioss, bs-4834R-FITC), CD90 (FITC anti-rat CD90 Antibody, BioLegend, 202503), CD105 (CD105 Monoclonal Antibody, FITC, Thermo Fisher Scientific, MA1-19594), CD14 (Anti-CD14/FITC antibody, Bioss, bs-1192R-FITC), CD34 (CD34 Monoclonal Antibody, FITC, Thermo Fisher Scientific, 11-0341-82), CD45 (CD45 Monoclonal Antibody, FITC, Thermo Fisher Scientific, 11-0451-82), and CD106 (CD106 antibody/FITC, Biorbyt, orb434364)) were detected by flow cytometry (BECKMAN COULTER, B53000), and then the Rat Adipose MSC Lipogenic (OriCell, RAXMD-90031), Osteogenic (OriCell, RAXMD-90021), and Chondrogenic (OriCell, RAXMD-90041) Induced Differentiation Kit for trilineage-induced differentiation was used to identify the cells.

Isolation and identification of ADSCs-Exos

The ADSCs were cultured in exosome-depleted medium for 48–72 h to collect the medium and were then removed by centrifuging at 4 ℃ and 300 g for 10 min. Death cells was removed by centrifuging at 4 ℃ and 2000 g for 10 min. Then, the cell debris was removed by centrifuging at 4 ℃ and 10,000 g for 30 min. Next, the medium was twice ultracentrifuged at 4 ℃ and 100,000 g for 70 min to purify the exosomes. Transmission electron microscopy (Japan Electronics Co., Ltd, JEM-F200) was used to examine the shape of exosomes; western blotting was used to identify the expression of CD9, CD63, and TSG101 in exosomes; and nanosight particle size analysis (ParticleMetrix, ZetaView PMX 110) was used to identify the dispersion of exosomes. The exosome-depleted medium consisted of 90% DMEM (high glucose, Procell, PM150210), 9% exosome-depleted FBS (Systembio, EXO-FBS-250 A-1), and 1% penicillin-streptomycin solution (Gibico, 15140122).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total ribonucleic acid (RNA) was extracted with TRIzol reagent (Absin, abs9331), and a nanodrop spectrophotometer (NanoDrop Lite Plus Microvolume Spectrophotometer, Thermo Scientific, NDL-PLUS-CN) was used to measure the purity and quantity of the isolated RNA. The isolated RNA could be kept at -80 °C if it wasn’t going to be used right away. Genomic deoxyribonucleic acid (DNA) was first eliminated, and then, using the SYBR® Green Premix Pro Taq HS qPCR Kit (Accurate Biology, AG11702), it was amplified. By using β-actin as the endogenous loading for mRNA, the 2−ΔΔCt method was used to assess the value of gene expression. The following primer pairs were applied to detect the rat cDNAs: TSPAN6-F: ACACTTTCATCTTTTGGATCACTGG, TSPAN6-R: ACAAAAGGCACATTGGT-GGC, β-actin-F: CCCATCTATGAGGGTT-ACGC, and β-actin-R: TTTAATGTCACGCACGATTTC.

Western blotting

From tissues or cell lysates, total protein was extracted using radioimmunoprecipitation assay (RIPA) buffer (Beyotime, P0013B). The protein sample was conducted on sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE) (NCM Biotech, P2012) and then transferred onto polyvinylidene fluoride (PVDF) membranes following concentration analysis using the BCA Kit (Bioss, C05-02001). The membranes were blocked by 5% non-fat milk at 25 °C for 1 h and reacted with TSPAN6 (Proteintech, 1:1000, 12293-1-AP), CD9 (Abcam, 1:1000, ab307085), CD63 (Santa Cruz, 1:1000, sc-5275), TSG101 (Abcam, 1:10000, ab125011), syntenin-1 (Santa Cruz, 1:1000, sc-515538), and β-actin (Abcam, 1:5000, ab6276) primary antibodies overnight at 4 °C. The use of horse radish peroxidase (HRP)-conjugated secondary antibodies (Thermo Fisher Scientific, 32460) was followed by the detection of the protein bands using the enhanced chemiluminescence (ECL) reagent (Zenbio, 17046) and then captured with the Bio-Rad system (Bio-Rad, ChemiDoc XRS+). Image J was used to analyze the level of protein expression using endogenous loading of β-actin.

Cells proliferation assay

Cell proliferation was measured using a Cell Counting Kit-8 assay (CCK-8, Solarbio, CA1210). ADSCs, HUVECs, and HSFs (1.5 × 103 cells/well) were seeded onto 96-well plates and cultured in exosome-depleted medium with 100 µg/mL of ADSCs-Exos or an equivalent volume of exosome diluent (phosphate buffer saline, PBS). The blank group was a collection without any cells. CCK-8 solution (10 µL/well) was added to the medium on days 1, 2, 3, 4, and 5. Cells were incubated at 37 ℃ for 2 h. A microplate spectrophotometer (Multiskan SkyHigh Microplate Spectrophotometer, Thermo Fisher Scientific, A51119600DPC) was used to quantify the absorbance at 450 nm, and the optical density data represented the rate of cell proliferation.

Immunocytochemistry

Polyethyleneimine was applied to round coverslips to promote cell growth, and 4% paraformaldehyde in PBS was used to fix the cells. After immersing in antigen retrieval buffer for 10 min, the coverslips were washed with PBS. Samples were incubated in PBS with either 0.1–0.25% Triton X-100 (Biosharp, BL934A) for 10 min. To prevent unspecific antibody binding, cells were incubated for 30 min in PBST (PBS + 0.1% Tween 20) containing 1% bovine serum albumin (BSA) (Biosharp, BS114) and 22.52 mg/mL glycine. In a humidified chamber, cells were incubated in diluted primary antibody in 1% BSA in PBST for 1 h at room temperature or for the entire night at 4°C. Then, cells were incubated for 1 h at room temperature in the dark with the secondary antibody in 1% BSA. Next, cells were provided with one-minute 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) incubation. Finally, the images were gathered using a fluorescent microscope (Carl Zeiss, Axi Vert A1).

Co-immunoprecipitation (Co-IP)

The Pierce Co-IP kit (Thermo Fisher Scientific, 26149) was used as a guide during this process. The IP lysate was pre-cooled on ice before being put into the cell culture dishes, where it was lysed for 5 min on ice after the cells had been twice cleaned with PBS buffer. A control agarose resin was used to pretreat cell lysates. Furthermore, three IP lysate washes were conducted after adding protein lysates to the resin that had been cross-linked with antibodies and incubating at 4 ℃ for the entire night. Western blotting was used to detect bound proteins after they were eluted.

Yeast two-hybrid assay

Subcloning vectors for TSPAN6 and syntenin-1 were designed to amplify and guarantee plasmid yields greater than 200 ng. Yeast extract Peptone Dextrose Adenine (YPDA) medium (Coolaber, PM2011) was used to cultivate monoclonal yeast species, and the resulting organisms were collected. The bacteria were resuspended using 1× TE/LiAc solution (TaKaRa, 630439), and each tube of the reaction system received two plasmids (1 µg each). Subsequently, 5 µL of pre-denatured Carrier DNA (TaKaRa, 630440) was added first, followed by 300 µL of 1×PEG/LiAc, and mixed thoroughly and left at 30 ℃ for 30 min. Each tube was filled with 20 µL of dimethyl sulfoxide (DMSO) (Solarbio, D8371), mixed, and water-bathed for 15 min at 42 °C. The reaction tubes were centrifuged and resuspended in YPDA Plus liquid medium for 60 min. The organisms were then resuspended with saline and spread out on SD/-Trp/-Leu and SD/-Trp/-Leu/-His/-Ade plates (Coolaber, PM2221, PM2111), respectively, and incubated in a biochemical incubator.

Wound healing assay

After inoculating HUVECs/HSFs (iCell, iCell-h110, iCell-0051a) into 6-well plates, care was taken to maintain a constant cell density in each well, ideally under control so that the cells would grow into a complete monolayer by the second day. The midline of the wells was scraped through using a 10 µL pipette head. After removing the original medium, the cells were cleaned three times using a sterile PBS buffer, and the suitable medium for culture was chosen based on the needs of the experiment. Under an inverted microscope (Olympus, CKX53), the scratch width was measured, and after 12 h of culture, the difference in width was recorded. Image J was used to assess the HUVECs’ and HSFs’ capacity for migration.

Transwell assay

The Transwell plate (Corning, 3422) was divided into two chambers: the upper chamber and the lower chamber. Resuspended in 100 µL of serum-free medium, 1 × 104 cells/well of HUVECs/HSFs were seeded in the upper chamber. After applying approximately 600 µL of different treatments into the lower chamber for 24 h, the transwell chambers were thoroughly cleaned three times using PBS. The cells were then fixed for 30 min with 4% paraformaldehyde and stained for 30 min with 0.1% (w/v) crystal violet (Abiowell, AWC0142a). After staining, the average numbers of cells that invaded the membrane were determined via microscopy (Olympus, CKX53).

Tube formation assay

Following an overnight thawing period in a 4 °C refrigerator, 200 µL of Matrigel (Corning, 354234) was added to each pre-cooling 24-well plate, and the plate was equally swirled on ice to prevent the Matrigel from gelling too soon. The 24-well plate was then incubated for 1 h in the culture incubator to facilitate Matrigel gelation. Following the seeding of HUVECs (1 × 105 cells/well) onto Matrigel-coated 24-well plates, the cells were treated with either PBS or exosomes (100 µg/mL) from different groups. An inverted light microscope (Olympus, CKX53) was used to view tube formation nine hours after seeding, and ImageJ was used to count the tube formation.

Animal operation

Twenty-seven 6-week-old male SD rats, weighting 160–180 g, were obtained from Hunan SJA Laboratory Animal Co., Ltd and randomly divided into three groups (9 rats/group): the ADSCsTSPAN6+-Exos group, the ADSCs-Exos group, and the control group. A computer-based random order generator was used to produce random numbers. Every animal received therapy at the same time each treatment day, with randomization used to establish the trauma area counts and the order of exosome injections. The rats were anesthetized by inhaling isoflurane (0.41 mL/min at 4 L/min fresh gas flow, 2%) and then receiving 1.5% sodium pentobarbital (60 mg/kg) intraperitoneally. The rats were given circular, full-thickness wounds of 2 cm in diameter on their backs. PBS, ADSCs-Exos, or ADSCsTSPAN6+-Exos were subsequently applied to the wounds. Starting on day 0, the exosome injection regimen was carried out every three days. Eight spots along the periphery of every circular incision received subcutaneous injections. 200 µL of exosomes at a concentration of 1 µg/µL were given to one rat, while 200 µL of PBS buffer was given to the control group. Following the procedure, a skin patch was applied to the wounds, and all of the rats were returned to the biosafety facility. The animals were excluded if they died prematurely, preventing the collection of behavioral and histological data. However, there were no exclusions during this study. Nine rats were divided into each group for the purposes of evaluating the healing of wounds (n = 9); three rats for each group underwent hematoxylin-eosin (HE) staining (n = 3); three rats underwent Masson staining (n = 3); and three rats underwent immunofluorescence staining (n = 3). We collected a minimum of three samples for each outcome index. Four researchers worked on each rat: the first was in charge of randomly assigning each animal to a group and was the only one who knew which animal was in which treatment group. Although the second researcher was in charge of performing the experiments, he was unaware of the treatment that each animal received. The third researcher was in charge of gathering experimental data, but he was also blind to the treatments that each animal had undergone. In charge of data analysis, the fourth researcher was aware of which animals belonged to the same group but not the precise treatments they had all received. At days 0, 3, 6, 9, 12, and 15 postoperatively, the skin patch was removed, and a digital camera was then used to take pictures of the wounds’ healing results. The wound area was measured and examined using ImageJ software. On day 15, all rats were euthanized by intraperitoneal injection of pentobarbital sodium at an injection dose of 180 mg/Kg. The formula [(C0-Ct)/C0] ×100% was used to calculate the wound healing rates. The wound dimension at day 0 was denoted by C0, and the wound dimension at each time point was represented by Ct. (The work has been reported in line with the ARRIVE guidelines 2.0, Additional file 5)

Histological and immunofluorescence analysis

The excised tissues, which included the wound bed and the surrounding healthy skin on day 15 after the wound, were preserved in 10% formalin, dried using a series of increasing alcohol concentrations, embedded in paraffin, and sectioned into 4-µm-thick pieces perpendicular to the wound surface for histological examination. Histological observations of wound scar width (the distance between the ends of scars during wound healing) were made using HE staining. Masson staining was utilized to determine the collagen maturity level (collagen content per unit area of tissue) in the wound beds.

To ascertain the angiogenesis of wound beds, immunofluorescence (IF) staining for CD31 (Abcam, 1:200, ab222783) and α-smooth muscle actin (α-SMA) (Abcam, 1:50, ab7817) was performed. Briefly, the sections were rehydrated and treated with citric acid (pH 6.0) to retrieve the antigen, blocked with BSA for 20 min, and finally incubated with antibody at 4 °C overnight. After three times PBS washes, the sections were incubated for 60 min at 37 °C with a secondary antibody labeled with fluorescein isothiocyanate (Abcam, ab150079, ab150113). The nucleus was stained with 5 µg/mL DAPI. Then, an upright fluorescence microscope (Carl Zeiss, Axi Vert A1) was applied to observe the stained section in a dark chamber. ImageJ software was employed to count the number of new blood vessels per unit area.

Statistics

All data were shown as mean ± standard error of the mean (SEM). A one-way analysis of variance (ANOVA) was employed to evaluate the significance of the difference. A P < 0.05 was considered significant. All of the data were statistically compared using GraphPad Prism 9 software. One-way ANOVA was performed when the data were normally distributed with homogeneous variance. The Kruskal-Wallis H test was employed when there was heterogeneity in variances.