Establishment of ARDS rat model

Male Wistar rats, sourced from Vital River Laboratories, Beijing, China, underwent an acclimatization period of one week before the commencement of experiments and were systematically divided into seven groups: Control, ARDS, adeno-associated virus (AAV) negative control (NC), AAV-Fcgr2b, AAV-short hairpin RNA (sh)-NC, AAV-sh-Elk1, and AAV-sh-Elk1 + AAV-sh-Fcgr2b. To induce anesthesia, the rats received an intraperitoneal injection of 10% chloral hydrate (250 mg/kg). For the establishment of the ARDS model, 10 mg/kg of LPS was administered intratracheally to the Wistar rats, whereas an equivalent volume of saline was injected as a control measure. The adeno-associated virus interventions were executed via tail vein injection one week prior to LPS administration. Twelve hours post-LPS induction, the rats were anesthetized again with an intraperitoneal injection of 10% chloral hydrate (250 mg/kg). Arterial blood samples were then extracted from the carotid artery for subsequent analysis with a blood gas analyzer and for the determination of PaO2 to calculate the PaO2/FiO2 ratio. After the arterial blood collection, euthanasia was carried out using an overdose of sodium pentobarbital (Lai et al. 2016). All experiments involving animals were ratified by the Ethics Committee for Animal Experiments of Shanghai pulmonary hospital.

Collection of bronchoalveolar lavage fluid (BALF)

Subsequent to LPS administration, the Wistar rats received an intratracheal injection of 2 mL phosphate-buffered saline (PBS) combined with ethylene diamine tetraacetic acid for the purpose of bronchoalveolar lavage fluid (BALF) collection. The percentage of Th17 cells within the BALF was ascertained through flow cytometry. Protein levels in the BALF were quantified utilizing bicinchoninic acid (BCA) protein assay kits (P0010, Beyotime, Shanghai, China). Furthermore, the total cell count in the BALF was determined via the use of hemocytometer counting chambers.

Lung wet-to-dry weight (W/D) weight ratio

Lung W/D weight ratio was applied to evaluate the pulmonary edema. After euthanasia of rats, the lung tissues were obtained, cleaned using absorbent paper to remove exudate and residual blood from the surface, and weighed (wet weight). Next, the lung tissues were subjected to 48-h drying in a 65 °C oven and weighed (dry weight). Finally, the W/D weight ratio was calculated.

Vascular permeability

To assess pulmonary vascular permeability, the accumulation of Evans blue dye within the tissue was quantified. Evans blue (25 mg/kg, obtained from Sigma-Aldrich) was administered intravenously via the tail vein 2 h prior to lung collection. The extraction of Evans blue from the lungs was facilitated by incubating the tissue in 1 ml of formamide at 60 °C for 18 h. This was followed by perfusion with 5 ml of phosphate-buffered saline (PBS), homogenization in 1 ml PBS, and subsequent dual washes. The supernatant was then isolated through centrifugation at 5000 g for 30 min.

Immunohistochemistry

Following an overnight fixation in 4% paraformaldehyde at 4 °C, lung tissues underwent a series of preparatory steps including dehydration in graded alcohols, clarification in xylene, embedding in paraffin, and sectioning. Subsequently, the sections were deparaffinized in xylene, rehydrated through a graded alcohol series, and submerged in 3% H2O2 for 8 min to inhibit endogenous peroxidase activity. Antigen retrieval was then performed by subjecting the sections to microwave boiling in a citric acid-based solution three times. After cooling to ambient temperature, the sections were incubated with primary antibodies overnight at 4 °C within a humidified chamber, followed by incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000, ab205719/ab6721, Abcam, Cambridge, UK) at room temperature for 30 min. Development of the sections was achieved using a diaminobenzidine substrate, with the reaction halted by rinsing in tap water. The sections were counterstained with hematoxylin, subjected to a dehydration and clearing process, and finally mounted with neutral balsam. Microscopic examination facilitated the assessment of protein expression, quantified by the product of the H score (representing the percentage of area expressing the protein, ranging from 0 to 100%) and the intensity score (categorized into 4 levels: 0 = no staining, 1 = mild staining, 2 = moderate staining, and 3 = strong staining). The primary antibodies used were directed against Fcgr2b (1:100, 550,270, BD Biosciences, Bedford, MA, USA), retinoid-related orphan receptor-gammat (RORγt, 1:100, orb500718, Biorbyt, Cambridge, UK), and Elk1 (1:100, sc-365,876, Santa Cruz Biotechnology, Santa Cruz, CA, USA). Two pathologists, blinded to the study, used a multiheaded microscope to assess protein expression. They evaluated the intensity and distribution to agree on the H-score, calculated as ΣPi (i + 1), where i indicates the intensity of stained cells (0: negative, 1: weak positive, 2: moderate positive, 3: strong positive), and Pi represents the percentage of stained cells (Hsiao et al. 2023).

Immunofluorescence analysis

Pulmonary tissue sections underwent permeabilization using 0.15% Triton X-100 for a duration of 15 min, followed by blocking in 5% normal goat serum dissolved in PBS for one hour. They were then subjected to overnight incubation at 4 °C with antibodies targeting Fcgr2b or cleaved-Caspase-3. This step was succeeded by the application of secondary antibodies for a period of 30 min at ambient temperature, prior to the nuclei being stained with DAPI (Fluka) for 10 min. Immunofluorescence imaging was accomplished utilizing an LSM 880 confocal microscope (Zeiss).

Periodic acid-Schiff (PAS) staining

Rat lung tissue sections were initially processed through a dewaxing phase, followed by an oxidation step involving treatment with 1% periodic acid for 10 min. Subsequent to oxidation, the sections underwent thorough washing with distilled water. For the staining process, Schiff’s Reagent (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) was utilized for 20 min, succeeded by counterstaining with hematoxylin for 10 min. These procedures were conducted with precision at a strictly maintained temperature of 20 °C. Post-staining, the sections were subjected to examination and documentation using an optical microscope, facilitating detailed analysis.

Masson’s trichrome staining

Rat lung tissue sections underwent dewaxing in xylene, followed by rehydration through a graded ethanol series. Subsequently, the sections were stained with Weigert’s iron hematoxylin and differentiated in 1% hydrochloric acid in ethanol. They were then rinsed under running water to restore the blue hue, stained with ponceau-acid fuchsin, and treated with a 1% phosphomolybdic acid solution for 3 min. Following this, the sections were counterstained with aniline blue for 5 min and differentiated in glacial acetic acid for 1 min. After these staining procedures, the sections were dehydrated in 95% followed by absolute ethanol for 5 min each, cleared in xylene, and mounted with neutral balsam for microscopic examination to evaluate tissue fibrosis.

Flow cytometry

Cells in BALF were washed with PBS and resuspended in buffer. Then, cells underwent 30-min incubation with CD4-fluorescein isothiocyanate (11-0041-82, Invitrogen, Tokyo, Japan) and Interleukin (IL)-17 A-PE (12-7177-81, Invitrogen) at 10 °C, washing, resuspension in buffer, and detection on a flow cytometer.

Hematoxylin-eosin (HE) staining

Paraffin-embedded lung tissue sections were processed through deparaffinization, rehydration, and subsequently stained with hematoxylin for 5 min. Following staining, the sections were rinsed with tap water and differentiated in 1% hydrochloric acid in ethanol for 3 s. Once the sections had reverted to a blue hue upon exposure to tap water, they were stained with eosin for 3 min. The final steps involved clearing the sections in xylene, mounting with neutral gum, and subsequent imaging and examination under a microscope.

Enzyme-linked immunosorbent assay (ELISA)

BALF was centrifuged at 500 × g for 5 min to harvest the supernatant. IL-17 and IL-6 levels in BALF were determined via IL-17 (ml037365, Shanghai Enzyme-linked Biotechnology, Shanghai, China) and IL-6 (ab234570, Abcam) kits.

Cell cultivation and processing

Rat pulmonary microvascular endothelial cells (PMVECs, Procell, Wuhan, China) were cultured in complete medium specifically designed for rat PMVECs (CM-R001, Procell) within a humidified incubator set at 5% CO2 and 37 °C. Following enzymatic digestion, PMVECs were harvested and plated into 6-well plates at a density of 1 × 10^5 cells per well. Subsequently, PMVECs were transduced with various lentiviral constructs (VectorBuilder, Guangzhou, China) for a duration of 48 h. To establish an in vitro model of ARDS, PMVECs were exposed to 1 µg/mL LPS for 4 h to induce cellular injury.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from rat PMVECs and lung tissues utilizing Trizol reagent (Invitrogen) and its concentration was determined using the Hifair® III One Step RT-qPCR SYBR Green Kit (11143ES70, Yeasen Biotechnology, Shanghai, China). Relative gene expression levels were quantified employing the 2−ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the internal control for normalization. The specific primers used in this study are listed as follows: for Fcgr2b, the forward primer is TTCCGAAGGCTGTGGTGAAA and the reverse primer is TCCCTTCGCACATCAGTGTC; for Elk1, the forward primer is AGGAAGCTGAGGCAAGAGTTC and the reverse primer is CGCTCACCTTGCGGATGATA; for GAPDH, the forward primer is GCATCTTCTTGTGCAGTGCC and the reverse primer is GATGGTGATGGGGTTTCCCGT.

Cell counting kit (CCK)-8 assay

Cell viability was assessed using the CCK-8 assay (ab228554, Abcam). Briefly, following treatment with LPS, PMVECs were incubated with 10 µL of CCK-8 solution at 37 °C in the dark for 2 h. Subsequently, the absorbance was measured at 460 nm using a microplate reader.

Measurement of lactate dehydrogenase (LDH)

The LDH kit (C0016, Beyotime) was applied to evaluate the LPS-induced cytotoxicity. Following LPS treatment, PMVECs received 5-min centrifugation at 500 × g. The supernatant was added with the LDH assay reagent for LDH measurement. The cytotoxicity of PMVECs was calculated per the formula: cytotoxicity (%) = (absorbance of treated samples - absorbance of control)/(absorbance of maximum enzyme activity of cells - absorbance of control) × 100%.

TdT-mediated dUTP-biotin nick end-labeling (TUNEL)

The TUNEL assay (40307ES50, Yeasen Biotechnology) was employed to evaluate LPS-induced apoptosis in PMVECs. Initially, following enzymatic digestion, PMVECs were collected for slide preparation. Post-LPS treatment, the cells were fixed with 4% paraformaldehyde at room temperature for 30 min and permeabilized with 0.3% Triton X-100 for 5 min at room temperature. Subsequently, PMVECs were incubated with 100 µL of Equilibration Buffer for 30 min at room temperature, followed by incubation with TdT incubation buffer for 1 h at 37 °C in a humidified chamber away from light. After washing with PBS, the nuclei were stained with 4’,6-Diamidino-2-Phenylindole (DAPI) for 5 min. The enumeration of TUNEL-positive cells was conducted using a fluorescence microscope, and the proportion of apoptotic cells was quantitatively analyzed.

Tubule formation assay

LPS-treated rat PMVECs at a density of 1 × 10^4 cells per well were plated onto 96-well plates pre-coated with Matrigel and then incubated for 12 h in a humidified atmosphere containing 5% CO2 at 37 °C. Subsequent to incubation, tubule formation was visualized and captured using microscopy. The total length of the tubules was quantified utilizing Image J software along with the angiogenesis analyzer plug-in. The comparative analysis of tubule length between the two groups facilitated the evaluation of the angiogenic capacity of PMVECs.

Western blot

Total proteins from PMVECs and lung tissues were isolated using radio-immunoprecipitation assay lysis (20–188, Merck, Zurich, Switzerland), quantified using BCA, boiled in sample preparing buffer to prepare samples, and separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis. The separated proteins were transferred to PVDF membranes, which were sealed in 3% skimmed milk for 30 min and probed with diluted primary antibodies overnight at 4 °C. On the next day, PVDF membranes received washing and 1-h probing with HRP-coupled secondary antibody (1:5000, ab205719, Abcam) at room temperature. The used antibodies are as follows: Fcgr2b (1:1000, 550,270, BD Biosciences), vascular endothelial (VE)-cadherin (1:3000, sc-9989, Santa Cruz Biotechnology), β-catenin (1:3000, 13-8400, Invitrogen), Elk1 (1:1000, sc-365,876, Santa Cruz Biotechnology), GAPDH (1:5000, ab8245, Abcam).

ChIP-qPCR

ChIP kit (ab185913, Abcam) was employed for ChIP assay. PMVECs were cross-linked with formaldehyde for 15 min before 10-min glycine treatment for formaldehyde bursting. Following lysis with lysis buffer, PMVECs were sonicated to cut the chromatin into 200–1000 base pairs. Then, the mixture was immunoreacted with Elk1 (1:100, sc-365,876, Santa Cruz Biotechnology), histone 3 lysine 9 trimethylation (H3K9me3, 1:50, NBP1-30141, Novus Biologicals, Centennial, CO, USA) or IgG. After DNA and protein mixtures received elution with DNA release buffer and de-crosslinking with proteinase K, DNA was purified per the kit, and the enrichment of Fcgr2b promoter was measured by qPCR.

Dual-luciferase reporter assay

Fcgr2b promoters were inserted into the pGL3-basic vectors to construct the promoter luciferase reporter vectors, which were co-transfected with sh-NC/sh-Elk1 into PMVECs using FuGENE® 6 Transfection Reagent (E2691, Promega, Madison, WI, USA). Forty-eight h after transfection, the transcriptional regulation of Elk1 to Fcgr2b was assessed via Dual-Glo® Luciferase Assay System (E2920, Promega) by measuring cellular luciferase activity.

Statistical analysis

Data were analyzed using GraphPad Prism 8.0 statistical software, and values were denoted as mean ± standard deviation. Differences between two groups were compared using the t-test, and differences among multiple groups were compared using one-way or two-way analysis of variance with Tukey’s post-hoc test. Differences were statistically significant when P < 0.05.