Animals

12 healthy Wistar rats aged 8–10 weeks were housed overnight in cages with a male to female ratio of 2:1. On the following day, the male rats were removed, and the vaginal suppository of the female rats was examined in separate cages. The successful attachment of the vaginal suppository was considered indicative of a successful pregnancy. Rats in the 12.5-day gestation period were randomly assigned to two groups: Model group, in which intraperitoneal injections of VPA (600 mg/kg, 50 mg/ml) were administered, the offspring designated as the VPA group; Control group, in which the same dose of sterile saline was injected intraperitoneally, the offspring designated as the Con group. The offspring were weaned at postnatal day 21 (PND 21). For this study, only male offspring rats were chosen, 5 offspring rats in each group. The behavioral symptoms associated with the ASD model were then observed at PND 35. Prior to the experiment, a period of 7 days was allocated for the adaptive rearing of all rats. The rats were provided with standard feed in a sanitized environment and were granted unrestricted access to food and water. This study was approved by the Management and Use Committee of Experimental Animals of Guizhou Medical University (NO.2,100,584).

Behavioral test

(1) Three-chamber test: The experimental box was partitioned into chamber A, central chamber and chamber B. In the social ability tracking test stage, the time that the rats stayed in the central chamber and the time of olfactory contact communication with stranger 1 were observed. In the social novelty test stage, the olfactory contact communication time between the tested mice and stranger 1 or stranger 2 were observed. (2) Elevated plus maze test: The rats were positioned at the central of the maze, facing an open arm. The retention time in the open arm of rats was recorded. (3) Open field test: The rats were situated within the central area and granted unrestricted movement for 10 min. The retention time of the rats in the central area was recorded. (4) Marble-burying test: A cushion was placed inside the cage, upon which glass beads were deposited. Total number of marbles buried more than 2/3 within 30 min was recorded. (5) Self-grooming test: The rats were transferred to an empty box and granted unrestricted movement for 10 min The cumulative time of self-grooming was recorded within 10 min.

Tissue sample collection

On PND 7 and PND 28, 6 male offspring rats were anesthetized and executed. The prefrontal cortex (PFC) tissue of the rats was preserved on ice, frozen in liquid nitrogen and stored at -80℃. The offspring rats were randomly divided into 4 groups, 3 rats in each group. (1) normal PND 7 group; (2) normal PND 28 group; 3.ASD model PND 7 group; 4.ASD model PND 28 group.

ELISA assay

The levels of Interleukin-1β (IL-1β) and IL-4 in brain tissue of PFC area region were measured. IL-4 ELISA kit (MM-0191R2) and IL-1β ELISA kit (MM-0047R2) (Jiangsu Enzyme Immunity Industry Co., Ltd.). Frozen brain tissue was taken, homogenized, and centrifuged to obtain the supernatant. Each standard and sample well was then treated with 100 µl of horseradish peroxidase labeled detection antibody and incubated for 60 min. The liquid was discarded, and the board was washed. Substrates A and B (50 µl) were added to each well and incubated. 50 µl of stop solution was added to each well, and the OD value at a wavelength of 450 nm was determined.

Transmission electron microscope observation

The PFC tissue of rat brain was trimmed and sectioned into ultrathin slices. The tissue was subjected to double staining using uranium acetate and lead citrate, and the resulting ultrastructure was examined using a transmission electron microscope.

Immunofluorescence

Immunofluorescence double staining was used to observe the protein expression of brain PFC microglia phenotype IBA-1 + CD86, IBA-1 + CD206, IBA-1 + TREM2, TREM2 + DAP12. Brain tissue was isolated, fixed and dehydrated, and 8 μm sections were prepared. A sealing solution containing 5% BSA and 0.2% TritonX-100 was added. The primary antibody IBA-1, CD86, CD206, TREM2 and DAP12 were added separately and incubated. A mixed solution of secondary antibodies was added and incubated. The tablets were sealed with DAPI.

Cell culture and grouping

Both normal newborn rats and ASD newborn rats were euthanized, and the prefrontal cortex (HPC) was isolated. The brain tissue was sectioned, added with 0.25% trypsin, and homogenized through repeated agitation. Once the cells prone to adhesion had proliferated, the cell suspension containing non-adherent neurons and microglia was transferred to a separate cell culture vessel, and the mixed glial cells adhered to the surface during cultivation. The unattached cell suspension containing neurons was transferred to a cell culture bottle that had been pretreated with polylysine. Once the majority of neurons adhered to the wall, the culture medium was changed to a solution containing B27 to facilitate continued culture, with the majority of cells being neurons. The mixed glial cells that adhered to the wall after 4 h were cultured, and microglia were obtained using a shaking method.

The experiments were categorized into different groups: control microglia + control neurons (Con), ASD microglia + ASD neurons (ASD), ASD microglia + TREM2 overexpressed no load + ASD neurons (ASD + Trem2-NC), ASD microglia + TREM2 overexpressed adenovirus + ASD neurons (ASD + Trem2-OE) and ASD microglia + TREM2 interference vector + ASD neuron (ASD + Trem2-siRNA).

TREM2 interference and over-expression technology processing

With TREM2 as the target gene (NM_001106884.1, Gene ID: 301,227), the interference sequence was designed and synthesized by Anhui General Company. During usage, the dry powder siRNA underwent centrifugation at a speed of 3000 rPm for 1 min. ddH2O was added in accordance with the instructions, and the resulting mixture was agitated for 10 min to ensure complete dissolution of all dry powder adhering to the inner surface of the tube. A 20 μm siRNA solution was prepared, which was subjected to subpackaging and stored at -20 °C. The cells were transfected with the siRNA solution, and RNA were collected 48 h post-transfection.

The interference agent sequence employed was as follows: NC: Forward (5’-3’):UUCUCCGAACGUGUCACGUTT, Reverse (5’-3’):ACGUGACACGUUCGGAGAATT; TREM2(Norway rat) siRNA-603: Forward (5’-3’):CCGAGGAGUCAGAGAGUUUTT, Reverse (5’-3’):AAACUCUCUGACUCCUCGGTT; TREM2(Norway rat) siRNA-234: Forward (5’-3’):CCACAGUGCUGCAGGGUGUTT, Reverse (5’-3’):ACACCCUGCAGCACUGUGGTT; TREM2(Norway rat) siRNA-404: Forward (5’-3’):CAGAAUGGGAGCACGGUCATT, Reverse (5’-3’):UGACCGUGCUCCCAUUCUGTT.

The cells were transfected with adeno-associated virus encoding TREM2 (GeneChem Biotech, China) or adenovirus empty vector for 48 h. The titer of overexpressed TREM2 adenovirus was 9.20*1011 pfu/ml, and titer of Adeno CMV Null Adenovirus was 3.88*1011 pfu/ml.

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from brain tissue using Trizol reagent following the standard protocol (Invitrogen). The extracted RNA was reverse transcribed into cDNA. RT-qPCR was performed according to the published procedure. Primers were designed using Oligo 6.0 software (MBI, Cascade, CO) and were synthesized by Anhui General Bioengineering Co., Ltd. The relative quantitative calculation was 2−ΔΔCt. β-actin as internal reference.

The primer sequence was as follows. β-actin: Forward (5’-3’): GCCATGTACGTAGCCATCCA, Reverse (5’-3’): GAACCGCTCATTGCCGATAG, TTCCGTAGCCGGGATTTCGT; PSD-95: Forward (5’-3’):GAGGGGCTTCTACATTAGGGC, Reverse (5’-3’):CTTGACCACTCTCGTCGCTC; Gephyrin: Forward (5’-3’):AATTCTGGTGCAAGCTCGG, Reverse (5’-3’):CATTGAGTAAGTCATCTGGGTTGTC; SYN: Forward (5’-3’):ATTCGAGTACCCCTTCAGGC, Reverse (5’-3’):ACGAGGAGTAGTCCCCAACC, ACATTCGCATCCTGGGTAA. β-actin: Forward (5’-3’):GCCATGTACGTAGCCATCCA, Reverse (5’-3’):GAACCGCTCATTGCCGATAG; CD86: Forward (5’-3’):CCAGGCTCTACGACTTCACA, Reverse (5’-3’):GGTTTCGGGTATCCTTGCTT; CD206: Forward (5’-3’):GGTGCGGTACACTAACTGGG, Reverse (5’-3’):TTCCGTAGCCGGGATTTCGT; TREM2: Forward (5’-3’):TCCTGTTGCTGGTCACAGAG, Reverse (5’-3’):CTCCCATTCTGCTTCCTCAG; DAP12: Forward (5’-3’):CCTGGTGCTTTCTGTTCCTT, Reverse (5’-3’):ACATTCGCATCCTGGGTAA.

Western blot (WB)

For the extraction of total protein from brain tissue, the BCA method was employed to measure the protein concentration. SDS PAGE gel was prepared and loaded with the protein samples, which were transferred to a PVDF membrane. To prevent non-specific binding, 5% bovine serum albumin was used to seal the membrane. The primary antibodies were added: post synaptic density 95 (PSD-95), synaptophysin (SYN), Gephyrin, CD86, CD206, TREM2, DAP12, p-P38 MAPK, p-ELK-1, ELK-1 and Actin. The samples were incubated overnight at 4℃. secondary antibody was added and incubated, The samples were washed three times with TBST. β-actin served as internal control.

Statistical analysis

Statistical analysis using SPSS 26.0. Data are expressed as mean ± SD. t test or F test were employed to compare the differences between different groups. When P < 0.05, the difference was statistically significant.