Patient enrollment and GC samples collection

This study was approved by the Ethics Committee of Changzheng Hospital Affiliated with Naval Medical University (No. 2018SLYS1). All patients enrolled were undergoing in vitro fertilization-embryo transfer (IVF) or intracytoplasmic sperm injection (ICSI) treatments in reproductive medicine center and signed informed consent. Our study included 8 patients diagnosed as POI according to the ESHRE guideline [46], and 10 infertile women because of tubal or male factor, with normal ovarian response, regular menses, normal basal hormone levels and BMI 19–24, as the control group. Because POI patients had been treated with hormone replacement therapy, the basic hormone level and menstrual cycle have recovered, and the low AMH level (AMH < 1.5 ng/ml) reflecting poor ovarian reserve was the key inclusion criteria for POI. The major anthropometric variables and endocrine parameters of the women are listed in Table 1. All the human ovarian GC samples were collected from the discarded products of transvaginal oocyte retrieval and isolation. The preparation of GC samples in the laboratory followed our previous procedure [47].

Animals

Dancrfl/fl and CMV-Cre mice were constructed and purchased from Biocytogen Pharmaceuticals (Beijing) Co.,Ltd. Dancr gene is on the positive strand of chromosome 5, with a full length of 1.25 kb (NCBI ID: 70,036). The sgRNAs are designed to be approximately 2 kb upstream of Dancr and 500 kb downstream of Dancr in a non-conserved region. Dancrfl/fl mice was screened with genotype verification. CMV-Cre mice express Cre recombinase under the control of a human cytomegalovirus (CMV) promoter, active in most cells and tissues. Dancrfl/fl mice mated with CMV-Cre mice. Dancr gene knockout mice (Dancr−/−) were obtained after three generations and Dancr+/+ mice were a negative control for follow-up experiments. In other experiments, C57BL/6 mice, aged 8 weeks and 36 weeks, were purchased from SLAC Laboratory Animal Company. The following primers used for Dancr−/− genotyping were 5′loxP-F: GACCTCTAGCAAGTAGACCAGGGGA; 5′loxP-R: GTCTGTTATCTGGATCCTGTAGTCCTGG;3′loxP-F:GACCTCTAGCAAGTAGACCAGGGGA and 3′loxP-R:TCGGGCTAGTGCAGGTGTTAGCAGGT [48]. Animal were maintained at a temperature of 25 °C and a humidity of 50% to 60%, with a 12:12 h light–dark cycle with ad libitum water and food. All experiments were approved by the Ethics Committee of Changzheng Hospital Affiliated with Naval Medical University.

Estrous cycle and cage mating

8-week-old Dancr−/− or Dancr+/+ female mice were performed with vaginal smear once a day lasting for 20 days, and each group contained 12 mice. The slides were fixed with 90% ethanol for 5 min, Giemsa stained for 15 min, washed gently and dried. The types of cells in vaginal smears were evaluated by optical microscopy. With cytological evaluation, proportions of keratinized epithelial cell, nucleated epithelial cell and leukocytes as a criterion to determine the phase of estrous cycle [49]. There are three types of disordered estrous cycle in our study: a) prolonged estrous with normal diestrus; b) prolonged diestrus with normal estrous; c) prolonged estrous and diestrus.

Each mouse was weighed first, and there was no significant difference in mean weight between the Dancr−/− and Dancr+/+ groups. Each group contains 12 mice. 8-week-old female Dancr−/− mice and Dancr+/+ mice were 1:1 mated with 8-week-old male mice in the cage randomly. The next morning (day post coitum [DPC] 0.5), vaginal plug was detected. The female mice with vaginal plug were thought to be pregnant. If there’s not vaginal plug, the male mice were changed cages for further mating. The pregnant female mice were fed in the separate cages.

Mouse primary ovarian granulosa cells isolation

Both ovaries of sacrificed mice were carefully removed and cleaned with PBS gently. Place the ovaries into a dish under a stereo microscope for further operation. The antral follicles were punctured with a 1 ml disposable syringe and granulosa cells were extruded slowly. All of the granulosa cells were removed into EP tubes using a 10 µl pipette and digested with hyaluronidase at room temperature for 10 min. After washing with PBS for 3 times, the primary granulosa cells were prepared for subsequent experiments.

Cell lines and cell culture

The human ovarian granulosa cell lines KGN and COV434 kept in our laboratory with STR (short tandem repeat) identification were cultured in DMEM (HyClone, USA) supplemented with 1% fetal bovine serum (Gibco, USA) and 100 IU/mL penicillin–streptomycin at 37 °C in a humidified atmosphere of 5% CO2 and 95% air.

Enzyme linked immunosorbent assay (ELISA)

Mice whole blood was collected from the eye socket veins, and then balanced at 4 °C for 1 h, followed by centrifugation at 3000 rpm for 20 min. The upper serum was transferred and storage at -20 °C/-80 °C. The mice serum AMH, estradiol (E2), and FSH were measured with ELISA kits (Demeditec, Germany, DE1288/DE2693 & JianglaiBio, China, JL20476) according to manufacturer’s instructions.

Hematoxylin and eosin (HE) staining

The unilateral ovary tissues collected from 8-week-old Dancr−/− and Dancr+/+ mice were fixed in 4% paraformaldehyde (Sigma), dehydrated, and paraffin-embedded. Then the tissues were cut into continuous 4-μm-thick sections. One slide selected at interval of five, totally 20 sections per ovary tissue sample were obtained for HE staining. The follicles at each stage were counted separately and total follicles were counted.

Fluorescence in situ hybridization (ISH/FISH)

ISH/FISH probes for DANCR (Human:5’-CY3-TGGCTTGTGCCTGTAGTTGTCAACCTGCGC-CY3-3’; Mouse:5’-DIG-AGTGGGACATGAAGAAGGGGTGGGGCA-DIG-3’) were synthesized by Wuhan Servicebio Company. ISH/FISH was performed according to the protocol of FISH assay kit. Representative images were captured under a fluorescence microscope.

RNA extraction and quantitative real-time PCR (qPCR)

Total RNA from cells or tissues were extracted with TRIzol reagent and RNeasy Mini Kit (Qiagen), and were subsequently reverse transcribed into cDNA by PrimerScript™ RT Master Mix Kit (Takara). RNA quantitation was performed with TB Green Premix EX Taq kit (Takara) on the ABI QuantStudio6 system according to manufacturer’s protocol. The primers used for amplification of DANCR are listed in Supplementary Table 2.

Lentivirus vector and gene transduction

The lentiviral vector system pLKD-CMV-G&PR-U6 was performed to gene knockdown and overexpression in granulosa cell lines (KGN or COV434). The DANCR shRNA/overexpressed lentiviral vectors were constructed by OBiO Technology Corporation. (DANCR shRNA, 5′-GCAGCTGCCTCAGTTCTTA-3′; NC shRNA, 5′-TTCTCCGAACGTGTCACGT-3′). Cell infection was conducted as follows: the cultures were transfected with lentiviral particles according to OBiO Kit. After infection, the stable transfectants were selected using 2 mg/mL puromycin in the presence of 10% FBS for 72 h. The efficiency of DANCR downregulation in KGN and COV434 cells was confirmed by real-time qPCR. The qPCR primers were listed in the Table S2.

Cell proliferation and aging assays

Cell viability and proliferation was detected by cell counting kit (CCK)-8 (Dojindo, Japan) and 5-Ethynyl-20-Deoxyuridine (EdU) assay (RiboBio, China). Cell cycle was detected by flow cytometry with cells incubated with DNA staining solution (PBS containing 20 μg/ml RNase A and 20 μg/ ml PI) at 37 °C for 30 min in dark place. For cell aging evaluation, senescent-associated β-gal (SA-β-Gal) and γ-H2AX staining were performed, with imagines captured under microscopy.

Proteome microarray

The sense and anti-sense lncRNA DANCR for protein microarray screening were synthesized labeling with Cy5 dye. The HuProt microarray from Wayen biotechnologies, comprised of more than ~ 20,000 full length human proteins with N-terminal GST-fusions, were performed according to the manufacturer’s instructions. Specifically, proteome microarrays were blocked for 1 h at room temperature. The lncRNA was placed in blocking buffer and incubated with the proteome microarray at room temperature for 1 h. The microarrays were washed three times for 5 min each time with TBST and then three times with Milli-Q water. Dried slides were scanned using GenePix 4000B, and images were analyzed using GenePix Pro 6.0. Results are presented in Supplementary File (Table S1).

Western blotting (WB) and Co-immunoprecipitation (Co-IP)

Cells were lysed with radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China) containing Protease/Phosphatase Inhibitor Cocktail (Epizyme, Shanghai, China) in ice-cold. The abundance of total protein was determined using a BCA Protein Assay Kit (Beyotime, Shanghai, China). Equal amount protein per lane was loaded onto an SDS–polyacrylamide gel, electrophoresed and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA). After blocking with 5% nonfat milk for 1 h, the membranes were incubated with diluted primary antibodies γ-H2AX (Millipore, USA, 05–636-AF488); p53 (CST, USA, 2524); hNRNPC (Novusbio, USA, SN0652); P21(Affinity, USA, AF6290); β-actin (CST, USA, 4967/3700), GAPDH (CST, USA, 5174) overnight at 4 °C, then washed and incubated with indicated secondary antibodies (IRDye 680RD, IRDye800CW (Licor, USA, #c50408-02 #c50331-05). The Odyssey infrared scanner (Li-COR Biosciences, Nebraska, USA) was used to detect the protein bands and β-actin served as a loading control.

For Co-IP, the total protein was extracted as the WB protocol above. Antibodies for IP was incubated with magnetic beads (Thermo, USA, 88,802) for 40 min and washed with PBS for three times. Extracted protein and magnetic beads were incubated overnight at 4 °C. The magnetic beads were washed with PBS for 5 times, and 80 μl PBS was added to re-suspend the beads. After protein denaturation at 100 °C for 10 min, magnetic beads were removed by magnetic rack, and the protein sample was completely prepared for further WB detection.

RNA immunoprecipitation (RIP)

RNA-binding protein immunoprecipitation assays were performed by a Magna RIP Kit (Millipore, USA) according to the manufacturer’s methods. Cells were lysed in RIP lysis buffer, and magnetic beads with HNRNPC (Novusbio, #SN0652), P53 (CST, #2524) or IgG antibody were prepared. The immunoprecipitation reactions were carried out by incubating the RIP lysate and the beads-antibody complex together with rotation overnight at 4 °C. Immunoprecipitated RNAs were purified and analyzed by qPCR and normalized to the input control.

RNA pull down

DANCR plasmid was synthesized by OBiO Technology Corporation and extracted with plasmid extraction kit (Tiangen, China). SP6 and T7 enzymes were added overnight at 37 °C for enzyme digestion and transcription in vitro was performed with the kit. Biotin was labeled on the DANCR-RNA transcribed and incubated with Dynabeads (Invitrogen, USA, 65,001). Cell protein samples were prepared in advance and incubated with the Dynabeads-RNA complex at 4 °C overnight. The enriched protein was eluted and preserved for Western Blot to verify the protein lane.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.0 and image quantitative analyses were performed with Image J. Data are presented as the mean ± SEM. Student’s t-test for two groups and one-way ANOVA analysis for three or more groups were used for group comparisons. Fisher's precision probability test was used to analyze the proportion of disordered estrous cycles. Nonparametric t-test was used for the analysis of mice pregnancy rate. All the experiments were repeated more than three times, and p < 0.05 was considered statistically significant.