Figure 1. Distribution of the E. indica populations which collected seeds from 10 provinces in China. Each population was numbered and the color of the circle according to the results of different analysis in this research.

Figure 2. Results of STRUCTURE analysis for 59 populations using 14 EST-SSR markers: (a) Plot mean likelihood L(K) and variance per K value. (b) Plot of mean rate of change of the likelihood distribution L’(K) per K value. (c) Plot of absolute value of the second order rate of the change of the likelihood distribution |L’’(K)| per K value. (d) Estimation of population using Delta K value with cluster K ranging from 1 to 10. (e) Estimation of population structure based on STRUCTURE analysis.

Figure 3. Principal component analysis based on 14 EST-SSR markers in E. indica. Coordinate 1 explained 33.80% of the total variation and Coordinate 2 explained 15.53% of the total variation.

Figure 4. UPGMA analysis of 59 populations of E. indica by the Sequential Agglomerative Hierarchical and Nested Clustering (SAHN) module of the NTSYS-pc. The FIND module was used to identify all trees that could result from different choices of tied similarity or dissimilarity values.

Table 1. Summary of analyses of expressed sequence tag-simple repeat (EST-SSRs) in E. indica.

Table 1. Summary of analyses of expressed sequence tag-simple repeat (EST-SSRs) in E. indica.

ItemParametersNumberEST-SSRTotal number of sequences examined48852Total size of examined sequences (bp)41400899Total number of identified SSRs8391Number of SSR containing sequences6849Number of sequences containing more than 1 SSR1206Number of SSRs present in compound formation451

Table 2. Frequencies of different repeat motifs in SSRs in E. indica.

Table 2. Frequencies of different repeat motifs in SSRs in E. indica.

Repeats5678910111213141516+TotalPercentageA/T-----179163228519011063335340640.59C/G-----43382691414411852.20AC/GT-9336392322243---12412.87AG/CT-283174149147214805---1105312.55AT/AT-702220101452---01431.70CG/CG-7364-------0830.99AAC/GTT5229132-------0961.14AAG/CTT14354366-------02392.89AAT/ATT219123------10460.55ACC/GGT14057272-------02262.69ACG/CGT1364194-------01902.26ACT/AGT2135 -------1300.36AGC/CTG25796272-------03824.55AGG/CCT334151786---1---05706.79ATC/ATG9030193-------01421.69CCG/CGG896264765-------0124114.79Others981511010000111181.41Total218812685412461802085779322199124793808391100

Table 3. Characteristics of 14 selected EST-SSR markers in E. indica.

Table 3. Characteristics of 14 selected EST-SSR markers in E. indica.

Primer NameRepeatPrimer Sequence (5′-3′)TM
(°C)NaNeHoHeIPICSSR10(TTTG)5AACCAGTTCTTCCTCTGCCG
GCCAGCACACCACTCATTTG602.001.680.950.400.590.44SSR12(ATCC)5TCCTCCTCCTCTGCCCTTTT
GCATCCCACCGAACACACTA603.001.820.970.450.750.42SSR27(CGAT)5GGCTGCTGATGCTTAAACGG
TCTAGCTGAGGCAGGACAGT602.001.830.950.450.650.40SSR104(GAG)5GGGCTCTAGGGACTACACCA
GGCTTTCAGAAGGGCTGCTA603.001.070.980.070.170.07SSR105(CCG)5CGACCACGAGTTCTGCTTCT
CCCGCCCTCCAATTTCTCTT603.001.230.860.190.400.05SSR137(ATGT)5CTGTCTCTGCCCTCCAACAG
GGTAGCGTCCAGGATCATGC602.002.000.950.500.690.45SSR138(TATC)5TAACAGCGACCGCATCTACC
AACCTCGCCGTTGTTCAGAG603.001.760.920.430.690.35SSR142(TTTC)5ACACTCACTCCCTGATCCCT
CGGAGGCCCACGTTTCTTAT602.001.590.950.370.560.32SSR154(ATTT)5CGCGCGCATTTTCATCAGAT
CTTGGGATGCTCGTAGCCAT602.001.960.950.490.680.44SSR186(ATGT)5CTGTCTCTGCCCTCCAACAG
GGTAGCGTCCAGGATCATGC602.002.000.930.500.690.43SSR202(GAG)12CTCCACCATCTCCTTCCTCG
CACAAGAAGATCCCCGTGCT604.001.380.920.280.510.19SSR204(TCTCTT)10GCAGCAAGCCCATGATCTTG
TCAGCAGCTGAGCTTACTCC605.002.190.880.541.030.47SSR216(AT)12CGGTGCGTGACAGTCAAAAG
GCCTCCCTGATCCGTTCATC6011.004.530.330.781.780.48SSR224(TCAG)15TGGCTTACCAACAGGCACAA
AACAAACAACGCGTCTTGGC605.002.200.970.551.090.56Mean 3.501.940.890.430.740.36St. Dev 2.410.820.170.170.380.15

Table 4. Analysis of molecular variance (AMOVA) among E. indica populations and clustered groups.

Table 4. Analysis of molecular variance (AMOVA) among E. indica populations and clustered groups.

Source of Variationd.f.MSSS%TotalEst. Var.Among groups182.42782.427401.568Among populations573.987227.276421.638Total58 351.703823.205