Conceptualization, A.H. and L.Y.; methodology, Y.W.; software, A.H. and Y.W.; validation, P.G., Z.Y. and J.H.; formal analysis, A.H., Y.W. and P.G.; data curation, Z.Y. and J.H.; writing—original draft preparation, A.H. and Y.W.; writing—review and editing, A.H. and Y.W.; supervision, A.H.; project administration, A.H.; funding acquisition, L.Y. All authors have read and agreed to the published version of the manuscript.

Figure 1. Conserved domain analysis of CsALKBH proteins. Domains are represented by different colored boxes.

Figure 1. Conserved domain analysis of CsALKBH proteins. Domains are represented by different colored boxes.

Figure 2. Phylogenetic analysis of CsALKBH proteins among Citrus sinensis (red) and Arabidopsis thaliana (blue), the tree was divided into five clades, which are marked by different colors and named as ALKBH9/10-like, ALKBH6/7/8-like, and ALKBH1/2-like.

Figure 2. Phylogenetic analysis of CsALKBH proteins among Citrus sinensis (red) and Arabidopsis thaliana (blue), the tree was divided into five clades, which are marked by different colors and named as ALKBH9/10-like, ALKBH6/7/8-like, and ALKBH1/2-like.

Figure 3. Distribution of CsALKBH genes on chromosomes. The leftmost scale shows chromosome length. Chromosomes are represented by green bars.

Figure 3. Distribution of CsALKBH genes on chromosomes. The leftmost scale shows chromosome length. Chromosomes are represented by green bars.

Figure 4. Phylogenetic tree, gene structure, and motif analysis of CsALKBHs. (a) The phylogenetic tree of CsALKBH is divided into three groups. (b) Exon–intron structure of CsALKBH genes. (c) Distribution of all motifs identified by MEME.

Figure 4. Phylogenetic tree, gene structure, and motif analysis of CsALKBHs. (a) The phylogenetic tree of CsALKBH is divided into three groups. (b) Exon–intron structure of CsALKBH genes. (c) Distribution of all motifs identified by MEME.

Figure 5. Putative cis-elements existed in the 1.5 kb upstream region of CsALKBH genes. The elements are displayed in different colored boxes. The homeopathic elements are represented by different colored boxes and their names and functions.

Figure 5. Putative cis-elements existed in the 1.5 kb upstream region of CsALKBH genes. The elements are displayed in different colored boxes. The homeopathic elements are represented by different colored boxes and their names and functions.

Figure 6. Collinearity analysis of ALKBH gene family between Citrus sinensis and representative species. The blue line indicates the collinearity of the ALKBH gene family in Citrus sinensis and the corresponding representative species. Other collinearity between genomes is indicated by gray lines.

Figure 6. Collinearity analysis of ALKBH gene family between Citrus sinensis and representative species. The blue line indicates the collinearity of the ALKBH gene family in Citrus sinensis and the corresponding representative species. Other collinearity between genomes is indicated by gray lines.

Figure 7. Expression patterns of CsALKBH genes in various Citrus sinensis tissues. A heatmap of CsALKBH RNA-seq data in ten tissues at different developmental stages was created by TBtools. The expression values mapped to a color gradient from low (green) to high expression (red) are shown at the right of the figure.

Figure 7. Expression patterns of CsALKBH genes in various Citrus sinensis tissues. A heatmap of CsALKBH RNA-seq data in ten tissues at different developmental stages was created by TBtools. The expression values mapped to a color gradient from low (green) to high expression (red) are shown at the right of the figure.

Figure 8. Expression profile of ALKBH genes on citrus in different biotic stress by qPCR analysis. (a), qPCR analysis expression of ALKBH genes in response to CCDaV; (b), qPCR analysis expression of ALKBH genes in response to CYVCV; (c), qPCR analysis expression of ALKBH genes in response to CaLas infection. Each value represents the mean ± SE of three replicates. * represents p ≤ 0.05, ** represents p ≤ 0.01, *** represents p ≤ 0.001.

Figure 8. Expression profile of ALKBH genes on citrus in different biotic stress by qPCR analysis. (a), qPCR analysis expression of ALKBH genes in response to CCDaV; (b), qPCR analysis expression of ALKBH genes in response to CYVCV; (c), qPCR analysis expression of ALKBH genes in response to CaLas infection. Each value represents the mean ± SE of three replicates. * represents p ≤ 0.05, ** represents p ≤ 0.01, *** represents p ≤ 0.001.

Table 1. Detailed information of ALKBH genes family members in Citrus sinensis.

Table 1. Detailed information of ALKBH genes family members in Citrus sinensis.

Genome IDGene NameProtein Length (aa)Molecular Weight (KD)Isoelectric Point (PI)Instability IndexGRAVYSubcellular LocalizationCs7g10770CsALKBH1A36140.836.1255.08−0.433NucleusCs1g16870CsALKBH1B71478.266.5444.41−0.604NucleusCs6g09650CsALKBH1C45851.339.1153.01−0.625ChloroplastCs2g01630CsALKBH224128.229.5331.97−0.754NucleusCs6g01500CsALKBH619522.276.0554.00−0.172NucleusCs5g32950CsALKBH726029.614.4650.05−0.510Nucleusorange1.1t03596CsALKBH8913102.336.2555.40−0.399NucleusCs3g04140CsALKBH9A46451.928.5252.44−0.542NucleusCs1g25260CsALKBH9B51557.876.4647.36−0.618NucleusCs5g31840CsALKBH1054759.935.4454.43−0.340Nucleus

Table 2. Primer sequences of CsALKBH genes.

Table 2. Primer sequences of CsALKBH genes.

GeneForward Primer (5′–3′)Reverse Primer (5′–3′)CsALKBH1ATTCATACAATCAGAACGGTCACTTCCATACTTAACGCACCTCsALKBH1BAATATGAAACACCCCGAGTTAAAACAATCATGGGCGAGACsALKBH1CGCCGTCTGTTATTCCTTGTGAAAGTATGTCTTCCACGTTGCTCsALKBH2TTAATTTACAGTGGCTACAGGTTAAGCCAAATAGAAGAACTGACsALKBH6CTTACAATGATTACGCGAAGCATTATGCCTTGGTTAGGTTCsALKBH7ATAGATAACCCACATGCGGTACTGTTTGCGATTTATCTCGTCsALKBH8ATGGCTTCCGAATTCTACACCAGTGCGAAATGTGAAAGATACCCTCsALKBH9ATTCCTTCTGATGATACCGAAATCCTGCTCTAGTGAACCTGCsALKBH9BTTTTCAAATCTGATGGCCTACACCCTCGACTTATCCGTACsALKBH10TTCAGTGGCAACTAATACCAGATCACAAACAAGACTACGTCCAF-boxTTGGAAACTCTTTCGCCACTCAGCAACAAAATACCCGTCT