記住我
Conceptualization, P.K., J.S., G.F.W. and P.L.; methodology, P.K., J.S. and E.A.M.G.; software, P.K., J.S. and E.A.M.G.; validation, P.K., J.S. and E.A.M.G.; formal analysis, P.K., J.S. and E.A.M.G.; investigation, P.K. and J.S.; resources, G.F.W. and P.L.; data curation, P.K. and J.S.; writing—original draft preparation, P.K.; writing—review and editing, P.K., J.S., E.A.M.G., G.F.W. and P.L.; visualization, P.K.; supervision J.S., G.F.W. and P.L.; project administration, P.K., G.F.W. and P.L.; funding acquisition, G.F.W. and P.L. All authors have read and agreed to the published version of the manuscript.
Figure 1. Representative examples of histological sections of the liver from rainbow trout fed diets of control (CON), natural (ND2), and pure DON (PD2), restrictively for one week (a), six weeks (b), and ad libitum for two weeks (c). The yellow arrows indicate profound infiltration of presumed leucocytes; stars highlight necrotic areas; triangles show the presence of a haemorrhage; circles indicate pyknotic nuclei; and squares indicate pleomorphic nuclei. Staining: PAS-Crossman; Magnification: ×20; White scale bar = 200 µm.
Figure 1. Representative examples of histological sections of the liver from rainbow trout fed diets of control (CON), natural (ND2), and pure DON (PD2), restrictively for one week (a), six weeks (b), and ad libitum for two weeks (c). The yellow arrows indicate profound infiltration of presumed leucocytes; stars highlight necrotic areas; triangles show the presence of a haemorrhage; circles indicate pyknotic nuclei; and squares indicate pleomorphic nuclei. Staining: PAS-Crossman; Magnification: ×20; White scale bar = 200 µm.
Figure 2. Interaction effects between the experimental diets and exposure time on the (a) mucosal fold height in the pyloric caeca, (b) mucosal fold width in the hindgut, and (c) enterocyte width in the hindgut of rainbow trout. Experimental diets refer to control (CON), natural DON (ND2), and pure DON (PD2), and time to restrictive exposure for 6 days (week 1), 40 days (week 6), and ad libitum exposure for 15 days (week 8). The error bars indicate the standard error of the mean; NS: not significant, *: p ≤ 0.05, **: p ≤ 0.01, ***: p ≤ 0.001. Treatments lacking a common letter (a, b) are statistically different (p ≤ 0.05) according to Tukey’s multiple comparison test.
Figure 2. Interaction effects between the experimental diets and exposure time on the (a) mucosal fold height in the pyloric caeca, (b) mucosal fold width in the hindgut, and (c) enterocyte width in the hindgut of rainbow trout. Experimental diets refer to control (CON), natural DON (ND2), and pure DON (PD2), and time to restrictive exposure for 6 days (week 1), 40 days (week 6), and ad libitum exposure for 15 days (week 8). The error bars indicate the standard error of the mean; NS: not significant, *: p ≤ 0.05, **: p ≤ 0.01, ***: p ≤ 0.001. Treatments lacking a common letter (a, b) are statistically different (p ≤ 0.05) according to Tukey’s multiple comparison test.
Figure 3. Relative gene expression (fold change) of pro-inflammatory cytokines interleukin-1β, interleukin-8, and two copies of tumor necrosis factor-α at the end of the experimental period (week 8) in (a) the pyloric caeca and (b) the hindgut of rainbow trout fed the experimental diets: control (CON), natural (ND2), and pure DON (PD2). The number of records used in the statistical analysis per gene ranged from 13 to 14. Primer pairs were gene copy specific; accession numbers of the gene variants amplified can be found in Table 5. * refers to a significant difference compared to the CON diet (p ≤ 0.05).
Figure 3. Relative gene expression (fold change) of pro-inflammatory cytokines interleukin-1β, interleukin-8, and two copies of tumor necrosis factor-α at the end of the experimental period (week 8) in (a) the pyloric caeca and (b) the hindgut of rainbow trout fed the experimental diets: control (CON), natural (ND2), and pure DON (PD2). The number of records used in the statistical analysis per gene ranged from 13 to 14. Primer pairs were gene copy specific; accession numbers of the gene variants amplified can be found in Table 5. * refers to a significant difference compared to the CON diet (p ≤ 0.05).
Table 1. Effects of DON on the performance of rainbow trout fed the experimental diets: control (CON; DON < 100 µg/kg), naturally DON-contaminated diets (ND1; DON = 700 µg/kg and ND2; DON = 1200 µg/kg), and pure DON-contaminated diets (PD1; DON = 800 µg/kg and PD2; DON = 1600 µg/kg) during a 6-week restrictive feeding period.
Table 1. Effects of DON on the performance of rainbow trout fed the experimental diets: control (CON; DON < 100 µg/kg), naturally DON-contaminated diets (ND1; DON = 700 µg/kg and ND2; DON = 1200 µg/kg), and pure DON-contaminated diets (PD1; DON = 800 µg/kg and PD2; DON = 1600 µg/kg) during a 6-week restrictive feeding period.
Experimental Diets Performance ParametersCONND1ND2PD1PD2SEMp-ValueInitial BW (g)8.08.07.48.28.10.21NSFinal BW (g)36.536.135.536.835.50.31NSGrowth (g/d)0.710.700.700.720.680.008NSSGR (% BW/d)3.803.783.913.763.690.069NSFCR 0.680.700.700.690.710.008NSHSI (%)4.44.44.74.23.80.36NSCondition factor (K)2.12.01.82.01.90.09NSRetained protein (g/fish)4.2 b4.0 ab3.9 a4.1 b3.8 a0.05**Protein retention efficiency (%)51.0 c49.1 ac48.1 ab50.4 bc47.1 a0.59**Retained energy (MJ/fish)0.190.190.190.190.190.002NSEnergy retention efficiency (%)45.945.844.345.844.60.58NSTable 2. Effects of DON on the performance and feed intake capacity of rainbow trout fed the experimental diets: control (CON; DON < 100 µg/kg), naturally DON-contaminated diets (ND1; DON = 700 µg/kg and ND2; DON = 1200 µg/kg), and pure DON-contaminated diets (PD1; DON = 800 µg/kg and PD2; DON = 1600 µg/kg) during a 2-week ad libitum feeding period.
Table 2. Effects of DON on the performance and feed intake capacity of rainbow trout fed the experimental diets: control (CON; DON < 100 µg/kg), naturally DON-contaminated diets (ND1; DON = 700 µg/kg and ND2; DON = 1200 µg/kg), and pure DON-contaminated diets (PD1; DON = 800 µg/kg and PD2; DON = 1600 µg/kg) during a 2-week ad libitum feeding period.
Experimental Diets Performance ParametersCONND1ND2PD1PD2SEMp-ValueInitial BW (g)36.636.135.536.636.10.47NSFinal BW (g)67.8 a64.2 ab61.9 b65.1 ab63.1 ab1.06*Feed intake (g/fish/d)1.711.721.581.711.670.045NSFeed intake (g/kg0.8/d)18.919.518.919.219.20.48NSGrowth (g/d)2.09 a1.88 ab1.76 b1.90 ab1.80 b0.048**SGR (% BW/d)4.12 a3.84 ab3.70 b3.83 ab3.73 b0.064**FCR 0.79 a0.86 ab0.85 ab0.84 ab0.89 b0.017*HSI (%)3.93.43.83.03.00.40NSCondition factor (K)2.01.91.91.92.00.07NSTable 3. Pathological indicators observed in trout livers with histological assessment after both restricted (week 1 and week 6) and ad libitum (week 8) feeding of the experimental diets: control (CON), natural DON (ND2), and pure DON (PD2).
Table 3. Pathological indicators observed in trout livers with histological assessment after both restricted (week 1 and week 6) and ad libitum (week 8) feeding of the experimental diets: control (CON), natural DON (ND2), and pure DON (PD2).
Pathological Indicators Experimental Diets p-Value +WeekCONND2PD2SEMDietTimeDiet × TimeR2 (Fish Effect) ‡Vacuolization Score Glycogen #12.52.31.8 y 62.01.91.9 y0.19***NS*0.42 (NA)82.4 b2.0 b1.0 a,x Lipid #11.61.81.9 62.01.81.90.13NSNSNS0.16 (NA)81.92.02.0 Nuclei characteristics ++ Pyknotic (%)155 a95 b93 b 6338778 ***NSNS0.36 (0.50)823 a72 b15 a Pleomorphic (%)135 a82 b82 b 6256568 *NSNS0.29 (0.51)818 a83 b17 a Other indicators Necrosis (%)12862 y37 x 62522 x39 x NSNS**0.21 (0.22)818 a45 a, x, y93 b, y Necrosis score #10.31.20.5 x 60.40.50.5 x0.20*NS*0.35 (NA)80.2 a0.7 ab1.1 b y Haemorrhage (%)112 a50 b y13 a 655 x12 ***NS***0.15 (0.04)83 a15 b x30 b Inflammation (%)10 a2 a x13 b 63 a45 b y9 a *NS*0.17 (0.16)8522 y5Table 4. Ingredient composition, proximate, and mycotoxin analysis of the experimental diets: control (CON), naturally DON-contaminated diets (ND1 and ND2), and pure DON-contaminated diets (PD1 and PD2).
Table 4. Ingredient composition, proximate, and mycotoxin analysis of the experimental diets: control (CON), naturally DON-contaminated diets (ND1 and ND2), and pure DON-contaminated diets (PD1 and PD2).
Experimental DietsIngredient (%)CONND1ND2PD1PD2Wheat (no DON)40.0018.00-40.0040.00Wheat (DON contaminated)-22.0040.00--Pure DON---0.000090.00016LT fishmeal 49.0249.0249.0249.0249.02Fish oil9.909.909.909.909.90Mineral and vitamin premix 11.081.081.081.081.08Analysed nutrient composition 2 (%) Dry Matter96.594.394.093.395.7Protein41.841.541.341.741.6Fat15.816.316.216.316.2Ash9.79.99.89.89.5Gross Energy (MJ/kg)21.6221.6021.6421.6221.57Mycotoxins concentration (µg/kg) 2 DON 37067911927811566Enniatin A/A1 41.212.112.9--Enniatin B/B1 4-8.619.9--T2 Toxin--3.8--Ergotamin(in)e2.73.4-2.1-Ergocryptin(in)e4.1----Table 5. Summary of selected genes primer sequences used for RT-qPCR.
Table 5. Summary of selected genes primer sequences used for RT-qPCR.
Target GeneAccession NumberForward Primer Sequence 5’-3’Reverse Primer Sequence 5’-3’elf-1αAF498320.1TCTACAAAATCGGCGGTACCTCAGTGGTGACATTAGCil-1βAJ557021.2CACCACCACCACCAATAAGAGGAAGCGAACCG il-8 +NM001124362.1TGTCAGCCAGCCTTGACATCCAGACAAATCTCCTtnf-αAJ277604.2GGCTGTGTGGGGTCGCTTCAATGTATGGTGGGtnf-α3HE798146.1TACCAAGAAACAAGATCACATCTGTCCACTCCACTGA
留言 (0)