Subjects and samples

The cohort study enrolled adult septic-ARDS patients (ages ≥ 18 years) meeting the criteria of Sepsis-3 and ARDS Berlin definition, and receiving invasive mechanical ventilation (IMV) treatment from the respiratory intensive care unit (RICU). Their plasma samples were obtained within 24 h after ARDS confirmation. The patients were excluded as follows: patients who died within 3 days; patients with diabetes mellitus or hypercholesterolemia; patients who received lipid-modifying therapies (statin drugs use); pregnant women; inability to obtain informed consent. Moreover, adult healthy volunteers from the health examination center of Beijing Chaoyang Hospital were included. All subjects or their representatives signed the informed consent. This study was approved by the Ethics Committee of Beijing Chao-yang Hospital (approval No.: 2021-ke-313) and Beijing You-an Hospital (approval No.: LL-2021-148-K).

Data collection

Demographic and clinical data like age, sex, body mass index (BMI), underlying diseases, etiology, acute physiology and chronic health evaluation II (APACHE II) score, sequential organ failure assessment (SOFA) score, laboratory data at admission, complications, treatment during RICU and prognosis were collected. Patients were divided into a survivor group and a non-survivor group based on ARDS-related mortality within 28 days after admission.

HDL isolation

HDL (density 1.063–1.210 g/ml) was isolated from plasma by discontinuous density gradient ultracentrifugation as previously described [21]. For data-independent acquisition mass spectrometry (DIA-MS) proteomic assay, the plasma from 2 individuals with similar demographic and clinical situations (including age, sex, BMI, underlying diseases, etiology, APACHE II score, SOFA score and prognosis) were pooled to identify changed HDL components efficiently. The purity of HDL was confirmed by the 10% SDS-PAGE electrophoresis and immunoblot of apoA-I (Santa Cruz, sc-376818) and apoB (Sigma, AB742) (Supplemental Figure 1).

Cytokine measurement

Plasma levels of 38 cytokines were quantified by Luminex multiplex bead-based assay using MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel (Merck Millipore, HCYTA-60 K), according to the manufacturer’s protocols.

DIA-MS proteomic analysisSample preparation

The HDLs were centrifugated for 10 min at 12,000 rpmg and 4 °C to collect the supernatant. The protein concentration of each sample was measured using the BCA protein assay method.

SDS-PAGE electrophoresis

The 10 µg proteins of each sample were acquired and separated by 12% SDS-PAGE gel. Then, the separation gel was stained with Coomassie brilliant blue. Finally, the stained gel was scanned by an automatic digital gel image analysis system (Tanon 1600, China).

Protein digestion in solution

Take 50 µg protein from each sample, and dilute different groups of samples to the same concentration and volume. Add 25 mM DTT of the corresponding volume into the above protein solution to make the DTT final concentration about 5 mM, and incubate at 55 °C for 30 min. Then add the corresponding volume of iodoacetamide so that the final concentration is about 9 mM, and place in the dark for 15 min at room temperature. Then 6 times the volume of precooled acetone in the above system to precipitate the protein, and place it at − 20 °C for overnight. After precipitation, the samples were centrifuged at 8000g for 10 min at 4 °C to collect the precipitate. Add the corresponding volume of trypsin (protein: enzyme = 50:1 (m/m)) to redissolve the protein precipitate, then the solutions were incubated for digestion at 37 °C for 12 h. Finally, the samples were lyophilized or evaporated after enzymolysis.

Peptide labeling and desalting

Each sample was mixed with the internal standard (iRT, Biognosys, ThermoFisher) at a volume ratio of 1:10, then the peptides were subjected to desalting using SOLA™ SPE plates (ThermoFisher, 60,309–001).

Proteomic data acquisition

After desalting, peptides were separated on an 1100 HPLC System (Agilent) using an Agilent Zorbax Extend reversed-phase column (5 μm, 150 mm × 2.1 mm) at a flow rate of 250 ul/min and gradient elution was performed according to the following method [preparation of phase A (ACN-H2O (2: 98, v/v) and phase B (ACN-H2O (90: 10, v/v)]: 0 ~ 10 min, 2% B; 10 ~ 10.01 min, 2–5% B; 10.01–37 min, 5–20% B; 37–48 min, 20–40% B; 48–48.01 min, 40–90% B; 48.01–58 min, 90% B; 58–58.01 min, 90–2% B; 58.01–63 min, 2% B.

All analyses were performed by a Q-Exactive HF mass spectrometer (Thermo, USA) equipped with a Nanospray Flex source (Thermo, USA). Samples were loaded and separated by a C18 column (50 cm × 75 µm) on an EASY-nLC™ 1200 system (Thermo, USA). The flow rate was 300 nL/min and linear gradient was 90 min (0 ~ 60 min, 8–25% B; 60 ~ 79 min, 25–45% B; 79 ~ 80 min, 45–100% B; 80 ~ 90 min, 100% B; mobile phase A = 0.1% FA in water and B = 0.1% FA in 80%ACN).

For DDA parameters, the full MS scans were acquired in the mass range of 350–1650 m/z with a mass resolution of 120,000 and the automatic gain control (AGC) target value was set at 3 × 106. The 20 most intense peaks in MS were fragmented with higher-energy collisional dissociation (HCD) with a collision energy of 27. MS/MS spectra were obtained with a resolution of 30,000 with an AGC target of 2 × 105 and a max injection time of 80 ms. The Q Exactive HF dynamic exclusion was set for 40.0 s and run under positive mode.

For DIA parameters, the full MS scans were acquired in the mass range of 350–1250 m/z with a mass resolution of 120,000 and the AGC target value was set at 3 × 106. The 32 acquisition windows in MS were fragmented with HCD with a collision energy of 28, and each acquisition window has 26 m/z. MS/MS spectra were obtained with a resolution of 30,000 with an AGC target of 1 × 106, and the maximum injection time was set to auto and run under positive mode.

Data analysis

DIA data were analyzed with Spectronaut Pulsar (Biognosys) against the uniprot-reviewed-Homo sapiens-20200817 database. Database search was performed with Trypsin digestion specificity. Alkylation on cysteine was considered a fixed modification in the database search. Protein, peptide and PSM’s false discovery rate (FDR) all set to 0.01. For DIA data, the quantification FDR also set to 0.05. Quantity MS-level was set at MS2.

Protein areas were normalized, and principal component analysis (PCA) and t-tests were performed between HDLs from ARDS patients and healthy controls. Differentially expressed proteins (DEPs) were considered based on a fold-change of ≥ 1.2 or ≤ 0.83 and p < 0.05. Next, DEPs were annotated based on the Gene Ontology Consortium (GO), including cellular components, biological processes, and molecular functions.

Targeted proteomics

We used isotope-dilution parallel reaction monitoring (PRM) to quantify HDL proteins. Briefly, LC–MS/MS analyses were performed using an EASY-nLC™ 1200 UHPLC system (Thermo Fisher) coupled with a Q Exactive series mass spectrometer (Thermo Fisher).

LC–MS/MS analysis pre-experiment

A multistep gradient of 0.1% formic acid in water (solvent A) and 0.1% formic acid in acetonitrile (solvent B) was used for the separation. HDL peptides mixture (1 µg) were injected into a home-made C18 Nano-Trap column (2 cm × 75 μm, 3 μm) and peptides were separated on a home-made analytical column (15 cm × 150 μm, 1.9 μm). The separated peptides were analyzed by Q Exactive series mass spectrometer, with an ion source of Nanospray Flex™(ESI), spray voltage of 2.4 kV, and ion transport capillary temperature of 320 °C.

Full scan range from m/z 350 to 1500 with a resolution of 60,000 (at m/z 200), an AGC target value is 3 × 106, and a maximum ion injection time is 20 ms. The top 20 (40) precursors of the highest abundant in the full scan were selected and fragmented by HCD and analyzed in MS/MS, where the resolution is 15,000 (at m/z 200), the AGC target value is 5 × 104, the maximum ion injection time is 45 ms, a normalized collision energy of 27%, an intensity threshold of 2.2 × 104, and the dynamic exclusion parameter of 20 s. Raw data was searched using PD2.2 software with “missed cleavage” set to 0, and 1–3 unique peptides were selected for each protein.

After selecting the peptides, the information of the target peptide, such as m/z, charge number, and charge type, was input into the “inclusion list”. The mixed peptides described above were analyzed by “full scan” followed by “PRM” pattern. The chromatographic separation and full scan condition are the same as above. The PRM was set as the resolution of 30,000 (at 200 m/z) with an AGC target value of 5 × 104, a maximum ion injection time of 80 ms, a normalized collision energy of 27%. The off-line data was analyzed by Skyline software to determine whether the selected peptides were usable based on reproducibility and stability.

LC–MS/MS analysis

The same amount of trypsin treated-peptide of each sample was taken and spiked with an equal amount of the labeled peptide DSPSAPVNVTVR (red bold V for heavy isotope labeling) as an internal standard. Samples were analyzed using a “full scan” followed by a “PRM” pattern, as described above. The off-line data was analyzed by Skyline software, and the peak area was corrected using the internal standard peptide.

Based on the DIA-MS proteome analysis results, we selected 18 HDL proteins with the most significant fold changes for relative quantification. Peptides monitored for each protein by PRM analysis were shown in Supplemental Table 1.

Table 1 Characteristics of patients with septic ARDS and healthy subjects in discovery cohortConstruction of Pro-SFTPB enriched HDL

HDL (1 mg/ml, 250 μg, Sigma, L1567) was incubated with 16.5 μg recombinant human SFTPB (0.066 mg/ml, Sino Biological, 17,682-H08C1) in PBS containing 10 mM of reduced glutathione at 37 ℃ for 2 h. Then, the mixture was reisolated with ultrafiltration tubes to remove free SFTPB. Immunoblotting of SFTPB showed HDL successfully carried SFTPB (Santa Cruz, sc-13978).

Cell culture and differentiation

The THP1 cell line was obtained from ATCC, and cultured in RPMI 1640 medium supplemented with 10% FCS and 2 mmol/L L-glutamine. THP1 cells were differentiated using 100 µg/ml phorbol myristate acetate (PMA, Sigma) for 48 h. Differentiation of PMA-treated cells was enhanced after the initial 48 h stimulus by removing the PMA-containing media and then incubating the cells in fresh RPMI 1640 for 24 h.

Phagocytotic assay and intracellular ROS detection

The phagocytic activity of macrophages was assessed by quantifying the uptake of red fluorescent pHrodo bioparticles (Invitrogen, #P35360, USA). The THP1 cells were plated into 24-well plates at a density of 10,000 cells per well and then differentiated into macrophages. A suspension of E. coli particles was added to the cell culture microplate at a dilution of 1:20. The cell-particle mixture was then incubated for 30 min at 37 ℃ to evaluate the uptake activity using fluorescence microscopy.

Intracellular oxidative stress was assessed by detecting the generation of ROS using the fluorescent probe DCFH-DA (Beyotime, #S0033S, China). 30 min after HDL exposure, the Thp1-derived M0 cells were treated with 10 µM/mL DCFH-DA and incubated for 30 min at 37 ℃, avoiding light. Fluorescence intensity was measured with a Varioskan Flash microplate reader (ThermoFisher Scientific Inc., USA) with excitation at 488 nm and emission at 525 nm.

Quantitative real‑time PCR

Total RNA was extracted using Trizol (Invitrogen, 15,596,018) according to the manufacturer’s manual and the cDNA was synthesized using PrimeSTAR® Max DNA Polymerase (Takara, R045A). qPCR assay was performed using TB Green® Premix Ex Taq™ II (Takara, RR820) and the data were normalized to the GAPDH content and analyzed by the 2−△△Ct method relative to control groups. The primers used in qPCR are shown in the table below.

TNF-α

F

CCTCTCTCTAATCAGCCCTCTG

R

GAGGACCTGGGAGTAGATGAG

IL-1β

F

ATGATGGCTTATTACAGTGGCAA

R

GTCGGAGATTCGTAGCTGGA

IL-8

F

ACTGAGAGTGATTGAGAGTGGAC

R

AACCCTCTGCACCCAGTTTTC

MRC-1

F

GGGTTGCTATCACTCTCTATGC

R

TTTCTTGTCTGTTGCCGTAGTT

GAPDH

F

GAAGGTGAAGGTCGGAGTC

R

GAAGATGGTGATGGGATTTC

Statistical analysis

Categorical variables are presented as numbers and percentages. Continuous data are expressed as mean ± SEM (standard error of the mean) for normally distributed variables, and medians (25th ~ 75th percentiles) for no-normally distributed variables. Statistical comparisons between two groups were performed using the chi-squared test or Fisher’s exact test for categorical variables, the Mann–Whitney U test for non-normally distributed continuous variables, and the two-tailed Student’s t-test for normally distributed continuous variables. For the comparisons of three groups, the one-way ANOVA followed by a post hoc test was applied. Pearson correlation analysis was used to assess the correlation of pro-SFTPB with a panel of 38 cytokines and other HDL protein components. The simple linear regression was further used to test whether pro-SFTPB in HDL could capture effects on the SAA2 and PON3 contents. Furthermore, receiver operating characteristic (ROC) curves were depicted, and the area under the curves [AUC, with 95% confidence intervals (CIs)] were calculated to evaluate the value of pro-SFTPB level in HDL and SOFA score for the prediction of the 28-day mortality. A two-sided p < 0.05 was considered statistically significant, and data were analyzed using the SPSS software package (version 19.0, SPSS, Chicago, IL, USA).