Cell lines

The sources and growing conditions of human adenocarcinoma alveolar basal epithelial A549, human embryonic kidney epithelial HEK293T/17, and grivet (Chlorocebus aethiops (Linnaeus, 1758)) kidney epithelial Vero (CCL-81) and Vero E6 (BEI Resources, Manassas, VA, USA; #BR596) cells were described previously43,44.

Viruses

All experiments associated with replicating viruses were performed under maximum (biosafety level 4 [BSL-4]) containment at the Integrated Research Facility at Fort Detrick (IRF-Frederick; Fort Detrick, Frederick, MD, USA), according to approved standard operating procedures. LASV isolate Josiah85 (LASV) and domesticated guinea-pig-adapted LASV (GPA-LASV) were provided by the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID; Fort Detrick, Frederick, MD, USA). LASV, recombinant LASV (rLASV-WT), and rLASV/IGR-CD were grown, harvested, and titered by plaque assay as described previously43,44.

Plasmids

pCAGGS expression plasmids encoding L protein (pCAGGS LASV-L), and nucleoprotein (pCAGGS LASV-NP) of LASV, and Escherichia phage T7 RNA polymerase (pCAGGS-T7) have been described43,44. Plasmids encoding the LASV (isolate Josiah) small (S) and large (L) segment antigenomes (ag) under control of the T7 promoter (pT7-LASV-S(ag))—pT7-LASV-L(ag), pT7-LASV-L-IGR/S-S(ag), and pT7-LASV-GPC/CD(ag))—were generated as described43,44.

Rescue and propagation of rLASVs

HEK293T/17 cells (7 × 105 cells per well, 6-well plate format) were cotransfected with pCAGGS LASV-NP (0.8 µg), pCAGGS LASV-L (1.0 µg), pCAGGS-T7 (1.0 µg), and

using 2.0 µL/µg DNA of Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. At 6 h post-transfection, mixtures were replaced with Dulbecco’s Modified Eagle’s Medium (DMEM; Thermo Fisher Scientific) containing 2% heat-inactivated fetal bovine serum (FBS; MilliporeSigma, Burlington, MA, USA). Tissue-culture supernatants were collected on Day 3 and Day 6 post-transfection. On Day 6, transfected HEK293T/T17 cells were cocultured (1:1) with Vero cells. Tissue-culture supernatants were collected 4, 7, 11, and 15 d later. Virus titers were determined by plaque assay in Vero E6 cells, as described previously43,44. Plaques were counted manually on Day 6.

Virus growth kinetics

Vero (CCL-81) and A549 cells were seeded in 96-well plates (1 × 104 cells per well) and exposed to rLASV-WT or rLASV/IGR-CD, at multiplicities of infection (MOIs) of 0.01 and 0.1. Tissue-culture supernatants were collected at 4, 8, 16, 24, 48, 72, and 96 h post-exposure. Virus growth kinetics comparisons were performed via plaque assay and RT-qPCR, as described previously43,44.

Western blot analysis

Vero and A549 cells were exposed to rLASV-WT or rLASV/IGR-CD (MOIs of 0.01 and 0.1). At 16, 24, 48, 72, and 96 h post-exposure, cells were lysed with NuPAGE LDS Sample Buffer (4X) (Thermo Fisher Scientific) before removing them from the BSL-4 laboratory. Cell lysates were resolved into 4‒12% Bis-Tris NuPAGE gels (Thermo Fisher Scientific) and transferred to nitrocellulose membranes. Membranes were blocked with 5% nonfat milk in phosphate-buffered saline (PBS) (Thermo Fisher Scientific) with 0.1% TWEEN (MilliporeSigma) for 1 h at room temperature. Membranes were incubated overnight with anti-LASV GP2 polyclonal antibody, anti-LASV NP monoclonal antibody, or an anti-actin beta antibody as loading control, followed by incubation with horseradish-peroxidase-conjugated secondary antibodies (MilliporeSigma), all described previously43,44.

Electron microscopy

Vero cells were infected with rLASV-WT or rLASV/IGR-CD at an MOI of 5.0 and incubated in DMEM containing 2% heat-inactivated FBS for 72 h. Following incubation, the tissue-culture media were removed, and cells were washed in PBS. For conventional transmission electron microscopy, cells were preserved in 2.5% Glutaraldehyde (E.M. Sciences, Warrington, PA, USA), in Millonig’s Sodium Phosphate Buffer (Tousimis Research, Rockville, MD, USA). After fixation, the cells were washed in Millonig’s Buffer, incubated in 1.0% osmium tetroxide (E.M. Sciences), en bloc stained with uranyl acetate (E.M. Sciences), dehydrated in a series of graded ethanols, and infiltrated and embedded in Spurr Resin (E.M. Sciences). Resin blocks containing the cells were sliced to ultra-thin thickness, and 70-nm sections were collected on 150 mesh copper grids, stained with lead citrate, and examined in an FEI Tecnai Transmission Electron Microscope, operating at 80 kV. Both the rLASV-WT and rLASV/IGR-CD samples contained large numbers of cells and over 2,000 individual cell sections were examined from each sample.

Genetic stability assessment

The genetic stability of rLASV/IGR-CD was evaluated in cell culture after being serially passaged 20 times in Vero cells. Briefly, Vero cells were exposed to rLASV/IGR-CD in a 6-well plate (passage 1) at an MOI of 0.01. At 72 h post-exposure, tissue-culture supernatants (passage 2) were collected, and virus titers were measured by RT-qPCR. Then, fresh Vero cells were exposed to passage 2 supernatants (MOI = 0.01) to generate passage 3. This process was repeated to generate 18 serial passages.

Given the challenges associated with detection of infectious LASV by classic plaque assays, genomic copy equivalents (GCEs) were assayed by RT-qPCR. ePFU during serial passages of rLASV/IGR-CD in Vero cells was derived by using the same serial dilutions of the rLASV/IGR-CD stock to determine infectious titer by plaque assay and levels of viral genome RNA by RT-qPCR. For each dilution, the ratio of GCE to PFU values was calculated by dividing GCEs by PFU values. This information was used to assess ePFU values during serial passages of rLASV/IGR-CD in Vero cells to identify the time point with the most similar GCE:PFU ratio, which informed the incubation period of 72 h between passages. Conversion to ePFU was based on the value derived from the ratio of GCEs per mL to PFU/mL at 72 h post-infection.

Passages 2, 13, and 18 were inactivated with TRIzol LS (Thermo Fisher Scientific), and viral RNA was extracted using the KingFisher Sample Purification System and MagMAX Viral Pathogen Nucleic Acid Isolation Kit. Briefly, 400 µL of inactivated sample was added to 550 µL of binding solution and magnetic beads. After binding and washing steps (with 80% ethanol [VWR, Radnor, PA, USA]), samples were eluted into 50 µL of elution buffer (Thermo Fisher Scientific). Purified RNA was converted into cDNA using Superscript IV and random hexamers. Long (1.5–2.0 kb) overlapping amplicons were generated from the S and L segment using a custom-designed primer panel (Supplementary Table 2) and repliQa HiFi ToughMix (Quantabio, Beverly, MA, USA). Libraries were prepared using Illumina DNA Prep and sequenced using a NextSeq2000 sequencer (Illumina, San Diego, CA, USA). Sequence analysis and assembly were performed using a pipeline developed in house. Briefly, FASTQ files were quality-trimmed and then adapter- and primer-trimmed using BBDuk (Joint Genome Institute, Berkley, CA, USA). Trimmed FASTQ files were then aligned separately with the S and L segments using the MEM algorithm in Burrows–Wheeler Aligner v0.7.1786. Consensus sequences were generated using SAMtools v1.1687. Variant analysis was performed using Genome Analysis Toolkit (GATK) v4.4.0.0 haplotype caller88; GATK variant filtration was done with hard-filtering criteria for single-nucleotide polymorphisms (SNPs) and indels (Supplementary Table 3).

Animal studies

All animal studies were approved by the National Institutes of Health (NIH) National Institute of Allergy and Infectious Diseases (NIAID) Division of Clinical Research (DCR) Institutional Animal Care and Use Committee and performed in animal BSL-4 (ABSL-4) laboratories at the IRF-Frederick, an institute fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC). Domesticated guinea pigs (Cavia porcellus (Linnaeus, 1758)) were housed in the ABSL-4 laboratory, monitored daily for signs of disease, anesthetized using isoflurane for venipuncture of the anterior venae cavae, and exsanguinated prior to humane euthanasia when criteria were met or at study termination, followed by necropsies. Specifically, guinea pigs were anesthetized via inhalation using 4–5% isoflurane mixed in 100% oxygen to effect using an induction box. If necessary, anesthesia was maintained by continuous 2% isoflurane mixed in 100% oxygen using nose cones for the duration of the procedure. Guinea pigs with a clinical score of 3 were euthanized immediately, and all remaining animals were euthanized at study termination at 42 d post-exposure. Terminally, guinea pigs were deeply anesthetized by intraperitoneal injection of ketamine and xylazine or by inhalation of isoflurane, exsanguinated via direct cardiac puncture or by cutting of the caudal venae cavae and then euthanized by injecting an overdose of pentobarbital. Animal groups were blinded to all staff performing clinical observations and other downstream analyzes.

Evaluation of rLASV/IGR-CD attenuation in strain 13 guinea pigs

Strain 13 guinea pigs (5–16-week-old male and female), obtained from the IRF-Frederick breeding colony, were assigned to two groups of n = 8. Groups were established to distribute age and weight proportionally. Animals (n = 8) were exposed subcutaneously to 105 PFU of rLASV/IGR-CD or rLASV-WT. At 7, 14, 21, 28, 35, and 42 d post-exposure, blood was sampled from the cranial venae cavae to determine viral loads and antibody responses, as described previously43,44.

rLASV/IGR-CD vaccination studies in guinea pigs

Strain 13 guinea pigs (5–16-week-old male and female), obtained from the IRF-Frederick breeding colony, were assigned to two groups of n = 5. Hartley guinea pigs (7–9-week-old male and female), obtained from Charles River Laboratories, Saint Constant, QC, Canada, were assigned to three groups of n = 8. Groups were established to distribute age and weight proportionally. Strain 13 guinea pigs were vaccinated subcutaneously with PBS or 105 PFU of rLASV/IGR-CD. Hartley guinea pigs were vaccinated subcutaneously with PBS or 102 PFU or 104 PFU of rLASV/IGR-CD. Animals were observed daily for clinical signs for 30 d, and animal weights and temperatures were measured weekly. At 30 d, animals were exposed subcutaneously to rLASV-WT (strain 13) or intraperitoneally to GPA-LASV (Hartley). At -30, -23, -16, -9, -2, and 16 d post-exposure, blood was sampled from the cranial venae cavae to determine viral loads and antibody responses, as described previously43,44. Livers, spleens, kidneys, and lungs were collected at necropsy for pathology and viral-load analyzes.

Viral load measurements

Viral supernatant samples were collected during the in vitro growth kinetics experiments, whole blood was sampled at the indicated time points and just prior to necropsy, and tissue samples were collected at necropsy. Samples were inactivated with TRIzol LS (Thermo Fisher Scientific). Total RNA was isolated using the KingFisher Sample Purification System and MagMAX Viral Pathogen Nucleic Acid Isolation Kit (Thermo Fisher Scientific). Briefly, a volume of 200 µL of inactivated sample was added to 550 µL of binding solution and magnetic beads. After binding and washing steps (with 80% ethanol [VWR, Radnor, PA, USA]), samples were eluted into 70 µL of elution buffer (Thermo Fisher Scientific). Viral loads in the sample were measured using RT-qPCR with LASV L forward primer (GACGCTAGATCGCTCATGAAT), LASV L reverse primer (TTGGAGGATAGGGTTGGTTTG), and LASV L probe (56-FAM-TCTCAAACACTGATGGGTACAGCCT-36-TAMsp). The standard curve spanned 108 copies per reaction (upper limit of quantification [ULOQ]) through 10 copies per reaction (lower limit of quantification [LLOQ]). Transformed data from all samples were plotted in viral RNA copies (log10) per mL (blood or viral supernatant) or viral RNA copies (log10) per mg (tissue).

Antibody measurements

To measure LASV-specific antibody titers, an IgG enzyme-linked immunosorbent assay (ELISA) was developed in-house. LASV antigens used in this assay were crude cell extracts generated from LASV-WT-infected Vero cells. Extracts were lysed with radioimmunoprecipitation buffer (Cell Signaling Technology, Danvers, MA, USA) and gamma-irradiated (50 kGy) to inactivate replicative virus before removal from the BSL-4 laboratory. Plates were coated with LASV-infected cell extracts diluted in coating buffer (Biolegend, San Diego, CA, USA) at a concentration of 50 ng per well, and plates were stored at 4 °C. Plates were washed six times with PBST (PBS + 0.2% TWEEN 20 [MilliporeSigma]), and a volume of 300 μL of blocking buffer (PBST + 3% normal chicken serum [Abcam, Boston, MA, USA] + 2% non-fat milk [Thermo Fisher Scientific]) was added to each well. After incubation at 37 °C for 1 h, heat-inactivated irradiated plasma that was serially diluted two-fold was added to the plates, and plates were kept at 4°C overnight. After washing the plates six times with PBST, goat anti-guinea-pig IgG horseradish peroxidase (MilliporeSigma) was added. The plates were incubated at 37 °C for 1 h and washed again with PBST. Antibody-antigen complexes were revealed by adding 3,3ʹ,5,5ʹ-tetramethylbenzidine substrate (Thermo Fisher Scientific) and incubating for 10 min at room temperature, and the reaction was stopped with stop solution. The absorbance was read at 450 nm on an Infinite M1000 plate reader (Tecan, Morrisville, NC, USA). The average signal from normal guinea pig plasma plus 3× standard deviations was set as the cutoff value for endpoint titer measurement. Reciprocal serum dilutions corresponding to minimal binding were used to calculate titers.

Host chemokine/cytokine response assays

Host chemokines and cytokines were measured on a Luminex MAGPIX Multiplexing System (Luminex Corporation, Austin, TX, USA). Analytes in first panel (ID.MCTOMAG-70K-06) included CXCL2 (MIP-2), CXCL5(LIX), CXCL10 (IP-10), IL12B (IL12p40), IL13, and VEGFA. The second panel (ID.MTH17MAG-47K-10) measured IFNG, IFNL3 (IL-28B), IL5, IL12 (IL12p70), IL13, IL17A, IL22 (IL17E), IL23, IL25, and IL33. Briefly, sera isolated from blood collected from virus-exposed strain 13 guinea pigs were added to magnetic beads conjugated to antibodies that target the indicated analytes. After a series of washes, secondary antibodies conjugated to phycoerythrin were added to the magnetic beads and loaded into the MAGPIX instrument for analysis with the appropriate kits. Raw data were exported as CSV files and analyzed in Excel using Bioplex Results Generator 3.0 and Bioplex Manager 6.1. Concentrations of each analyte were based on the standard curve generated from standards provided by the manufacturer.

Histopathology, immunohistochemical, and in situ hybridization studies

Guinea pigs were humanely euthanized at the end of each experiment and complete necropsies were performed. All major organs were collected and fixed in 10% neutral-buffered formalin for at least 72 h in biosafety level 4 (BSL-4) containment before routine processing in a Tissue-Tek VIP-6 vacuum infiltration tissue processor (Sakura Finetek USA, Torrance, CA, USA), and paraffin-embedded via a Tissue-Tek TEC-6 embedding station with cryo module (Sakura Finetek USA, Torrance, CA). Paraffin-embedded tissues were sectioned at 4 µm using a standard semiautomated rotary microtome Leica RM2255 (Leica Biosystems, Buffalo Grove, IL, USA); mounted on positively charged glass slides; air-dried for routine hematoxylin and eosin (H&E) staining, IHC, or RNAscope in situ hybridization (ISH); and coverslipping with a nonalcohol-based mounting medium. IHC was performed with an anti-LASV-NP monoclonal antibody (Cambridge Biologics, Brookline, MA, USA; #01-04-0104), followed by a biotinylated secondary antibody and an avidin/biotin based tertiary antibody. RNAscope ISH was performed to detect LASV genomic RNA in formalin-fixed, routinely processed, paraffin-embedded, 4-µm sliced, mounted tissue sections on charged glass slides, using the manual RNAscope 2.5 HD RED Detection Kit (Advanced Cell Diagnostics, Newark, CA) in accordance with the manufacturer’s protocol, including modifications for optimization validated by appropriate controls. The probe pairs used targeted the LASV genomic Z and L genes (catalog no. 463761, ACD). Slides were examined by a pathologist and imaged as described previously43,44.

Isolation of splenocytes, cell banking, and thawing

Spleens were weighed, homogenized in c-tubes by Gentle MACS dissociation (Miltenyi, Gaithersburg, MD, USA), washed with 2% FBS PBS + 2 mM EDTA (PBS-2), strained through a 100-µM filter, ACK-lysed, and counted on a cell counter (Nexcelom, Lawrence, MA, USA). Isolated cells were washed with PBS-2, resuspended to approximately 5–30 × 106 live cells per mL in Recovery Cell Culture Freezing Medium (Thermo Fisher Scientific), aliquoted into Cryovials (Thermo Fisher Scientific), initially cryopreserved in a −80 °C freezer, and subsequently moved to long-term storage in a −150 °C freezer within 48 h.

Frozen splenocytes were thawed in a similar manner to procedures previously described89. In brief, frozen splenocyte cryovials were inverted and placed within CryoThaw Tube Adapters (Medax International, Salt Lake City, UT, USA) on 15-mL conical tubes containing 9 mL of PBS-2. Then, samples were washed with PBS-2 and resuspended in 1 mL of PBS-2. Thawed cells were counted, and up to 2.5 × 106 live splenocytes were aliquoted per sample for flow cytometry staining.

Antibody conjugation for flow cytometry panel

Unconjugated antibodies specific for guinea pig markers (Bio-Rad, Hercules, CA, USA) were conjugated at the IRF-Frederick to fluorescent dyes in accordance with company-provided protocols using the respective Lightning Link Fast Conjugation Kits (Abcam, Cambridge, UK) for the following antibodies of interest: rabbit anti-guinea-pig IgG, APC; mouse anti-guinea-pig T lymphocytes, APC-Cy7; mouse anti-guinea-pig CD8, PE-Cy5; mouse anti-guinea-pig CD1b3, PE-Cy7; and mouse anti-guinea-pig MHC Class II, PerCP-Cy5.5. A fraction of each conjugated antibody was tested by incubation with Invitrogen UltraComp eBeads (Thermo Fisher Scientific) to ensure proper antibody: fluorophore conjugation. Prior to staining study-related samples, all antibodies were titrated on banked PBMCs isolated from guinea pig whole blood (Biochemed Services, Winchester, VA, USA). The respective conjugated antibodies were each aliquoted and stored per company provided protocols.

Flow cytometry staining and acquisition

Up to 2.5e6 isolated cells from spleen tissue samples were resuspended to a volume of 100 µL and blocked with 10 µL of normal guinea pig serum (Jackson ImmunoResearch, West Grove, PA, USA) for 10 min on ice to inhibit Fc receptor-specific binding. Blocked samples were stained with a cocktail of primary antibodies (CD45 FITC, CD4 PE, IgG APC, T-lymphocytes APC-Cy7, CD8 PE-Cy5, CD1b3 PE-Cy7, MHC-II PerCP-Cy5.5, and CD14 BV570) and amine-reactive dye Live Dead Blue (Thermo Fisher Scientific) for dead cell exclusion and then diluted in Brilliant Stain Buffer Plus (BD Biosciences, Franklin Lakes, NJ, USA) for 20–30 min on ice. Samples were washed, fixed, and inactivated for at least 30 min with a minimum of 500 µL of Cytofix/Cytoperm (BD Biosciences), resuspended in PBS, and run on a five-laser Aurora Flow Cytometer (Cytek Biosciences, Fremont, CA, USA) on low or medium flow rate settings. Flow data was analyzed in FlowJo software version 10.8.1.

Statistical analysis

The log-rank (Mantel–Cox) test was used for survival curve comparison. Statistically significant differences in animal weights/temps, ELISA endpoints, cytokine concentrations, and virus titers were determined by unpaired Student’s t-test. Statistically significant differences in cellular frequencies from the flow cytometry data were determined by grouped two-way ANOVA with multiple comparisons. (*p < 0.05, significant; **p < 0.01, very significant; ***p < 0.001, highly significant; n.s., p > 0.05, not significant). Prism 9 (GraphPad Software) was used for all statistical analyzes.