Cell culture

The murine macrophage cell lines RAW264.7 (TIB-71, American Type Culture Collection) were maintained in the Dulbecco’s Modified Eagle’s Medium (DMEM; Welgene, Gyeonsan, Korea), supplemented with 10% fetal bovine serum (Welgene) and 1% penicillin/streptomycin (Gibco BRL, Grand Island, NY, USA). Cells were incubated in a humidified atmosphere at 37 °C with 5% CO2.

Bacterial strains and culture

Sixteen Kp isolates were obtained from the various clinical specimens of Keimyung University Dongsan Hospital. From these strains, we collected the three hvKp strains (DSMC-K210, DSMC-K285, DSMC-K360) from blood specimens of patients with a liver abscess. These isolates were identified using the automated microbial identification and susceptibility test system (VITEK 2 system, bioMerieux, Lyon, France). Extended-spectrum β-lactamase (ESBL) production was confirmed by agar dilution test using cefotaxime and ceftazidime along with clavulanate, in accordance with the Clinical and Laboratory Standards Institute guidelines [20]. Capsular serotypes and genes of virulence factors were identified by polymerase chain reaction (PCR) [6, 21]. Strains were serotyped as: K1, K2, K5, K20, K54, and K57, or as non-determining when no specific serotype could be identified. Hypervirulent characteristics were confirmed with a string test and gene amplification of rmpA, magA, and aerobactin. According to serotype analysis, the three hvKp isolates were of the K1 serotype. HvKp had antibiotic susceptibility for most antibiotics except ampicillin.

Strains of Kp were grown in Luria-Bertani (LB) broth (Difco, Becton Dickinson, Sparks, MD, USA) for liquid culture and on LB agar (Difco) as a solid medium at 37 °C. All bacteria were stored at -80 °C in LB broth supplemented with 15% v/v glycerol (Sigma-Aldrich, St. Louis, MO, USA). For infection stocks, bacteria were incubated overnight and then diluted in fresh LB broth and cultured to an optical density (OD 600 nm) of 0.1. Samples were frozen at -80 °C with 15% glycerol, and one aliquot was counted prior to infection.

Infection and treatments

RAW264.7 cells were replated into 6-well or 24-well plates in complete DMEM medium at a density of 7 × 105 cells/well and infected with the different strains at multiplicity of infection (MOI) of 40 for 1 h. After that, cells were washed three times with PBS and incubated for an additional 1 h in a medium containing 300 µg/ml gentamicin (15710-072, Gibco) and 15 µg/ml polymyxin B (81271, Sigma-Aldrich) to remove non-phagocytosed bacteria. After incubation, media were removed again, and fresh media was added for the remainder of the experiment time. To inhibit the mTOR signaling pathway, 200 nM of rapamycin (553210, Sigma-Aldrich) was added to the cell culture and incubated for 30 min prior to hvKp infection. To impair the LDs biogenesis, 10 µM of diacylglycerol O-acyltransferase 1 (DGAT1) inhibitor (A922500, A1737, Sigma-Aldrich) or 15 nM of cytosolic phospholipase A2 (cPLA2) inhibitor (CAY10650, 10743, Cayman Chemical, Michigan, USA) were added to the cell culture and incubated for 1 h before hvKp infection, and this remained for the entire infection time, at 37 °C in 5% CO2. The inhibitors were dissolved in dimethyl sulfoxide (DMSO, 20–139, Sigma-Aldrich).

Cell proliferation assay

The rate of cell proliferation was evaluated using CellTiter 96® AQueous One Solution Cell Proliferation Assay (G3580, Promega, Madison, WI, USA). In brief, cells were seeded in a 96-well plate at a density of 3 × 104 cells per well. The cells were incubated at 37 °C in a 5% CO2 incubator for 18 h. Treatment of A922500 or CAY10650 were applied and incubated for 24 h. Subsequently, the cells were incubated with 20 µL of CellTiter 96® AQueous One Solution reagent for an additional 30 min. The absorbance was measured using a Synergy/HTX spectrophotometer (BioTek instrument, Inc. Winooski, VT, USA). All the readings were normalized to the control, and the control was considered as 100% live cells. An average of three experiments was performed.

Immunoblotting

Cells were lysed in RIPA lysis buffer (89900, Thermo Scientific™, Waltham, MA, USA) and supernatant fractions were collected. Protein concentrations were measured with bicinchoninic acid (Pierce, Rockford, IL, USA), and equal amounts of proteins (50 µg/lane) were separated by 8% sodium dodecyl-sulfate polyacrylamide gel electrophoresis and transferred to the nitrocellulose membranes (GE Healthcare Life Science, Pittsburgh, PA, USA) incubated with a specific antibody. The anti- fatty acid synthase (FAS, #3180, Cell Signaling Technology, Beverly, MA, USA), anti-perilipin 1 (PLIN1, NB100-449, Novus Biologicals, Centennial, CO, USA), anti-acetyl-CoA carboxylase 2 (ACC2, #3676, Cell Signaling Technology), anti- phospho- ACC2 (Ser79) (#3661, Cell Signaling Technology), anti- ACC1 (#4190, Cell Signaling Technology), anti-stearoyl-CoA desaturase-1 (SCD1, #2794, Cell Signaling Technology), anti-phospho-mTOR (Ser2448) (#2971, Cell Signaling Technology), anti-phospho-p70S6K (Thr421/Ser424) (#9204, Cell Signaling Technology), and phospho-S6 Ribosomal Protein (Ser235/236) (#2211, Cell Signaling Technology), anti-DGAT1 (#NB110-41487, Novus Biologicals) and anti-cPLA2 (#sc-454, Santa Cruz Biotechnology, Inc.) were used as primary antibodies. These antibodies were used at a dilution of 1:1,000. The anti-ACTB antibody (A5441) was acquired from Sigma-Aldrich (Merck KGaA) and used at a dilution of 1:5000. Secondary antibodies (anti-rabbit IgG [1:5,000 diluted; 111‑035‑045] and anti-mouse IgG [1: 5,000 diluted; 115‑035‑062]) were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Bands were detected using the Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore, Darmstadt, Germany).

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from infected cells and the lung, liver, and spleen tissues using TRIzol (15596-026, Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. Then, RNA was reverse transcribed to complementary DNA using the reverse transcriptase premix (EBT-1515, Elpis Biotech, Daejeon, Korea). Data were analyzed by the qTOWER3 PCR thermal cycler (Analytik Jena, Jena, Germany) using the THUNDERBIRD SYBR qPCR Mix (QPS-201, TOYOBO, Osaka, Japan). The gene expression was calculated using the 2ΔΔ threshold cycle (Ct) method and normalized to b-actin. The primer sequences (mouse) were as follows: Il6 forward: 5’- ACAAAGCCAGAGTCCTTCAGA-3’, reverse: 5’- TGGTCCTTAGCCACTCCTTC-3’; Tnfa forward: 5’- CCCACGTCGTAGCAAACCAC-3’, reverse: 5’- GCAGCCTTGTCCCTTGAAGA-3’; Agpat2 forward: 5’-AGCGGACAGAAGAAACTGGAGG-3’, reverse: 5’- TTAGCTCACGCTTGGCGATCTG-3’; Dgat2 forward: 5’- CTGTGCTCTACTTCACCTGGCT-3’, reverse: 5’-CTGGATGGGAAAGTAGTCTCGG-3’; Acaca forward: 5’-GATATCCCAGAGATGTTTCGGC-3’, reverse: 5’- GTCAGCATGTCAGAAGGCAGAG-3’; Scd1 forward: 5’-CCGAAGTCCACGCTCGAT- 3’, reverse: 5’-TGGAGATCTCTTGGAGCATGTG-3’; Fasn forward: 5’- CACAGTGCTCAAAGGACATGCC-3’, reverse: 5’ - CACCAGGTGTAGTGCCTTCCTC − 3’; and b-actin forward: 5’-CCACCATGTACCCAGGCATT-3’, reverse: 5’-AGGGTGTAAAACGCAGCTCA-3’.

Small interfering RNA transfection

For transient silencing of DGAT1 and cPLA2 in RAW264.7 murine macrophage cells, DGAT1 siRNA (#sc-40488), cPLA2 siRNA (#sc-35098), and a scrambled siRNA (#sc-37007) were obtained from Santa Cruz Biotechnology, Inc. All siRNAs were transfected using Lipofectamine® 2000 Reagent (11668027, Invitrogen, Carlsbad, CA, USA). RAW264.7 cells were seeded in 24-well plates at a density of 20 × 104 cells per well and transfected with the 200 nM siRNAs using Lipofectamine® 2000. After transfection at 4 h, the medium was changed to growth medium, and then transfected cells were infected with hvKp strains for 4–6 h. The cells were then harvested for ELISA measurements and CFU analysis.

Colony forming units (CFUs) assay from macrophage and mice organs

RAW264.7 cells were infected with hvKp at a MOI of 40 for 1 h at 37 °C, 5% CO2 in an antibiotic-free medium. After that, the cells were washed three times with PBS and incubated for an additional 1 h in a medium containing 300 µg/ml gentamicin and 15 µg/ml polymyxin B. Then, cells were washed and subsequently lysed with 1% saponins in PBS. 10-fold serial dilutions of the lysate were plated on LB agar plates incubating overnight at 37 °C to determine the number of CFUs. The lungs, livers, and spleens were harvested, homogenized in PBS, serially diluted in PBS, and plated on LB agar. Colonies formed in the plates were counted after 24 h of incubation.

Enzyme-linked immunosorbent assay (ELISA)

RAW264.7 cells were cultured in 24-well culture plates at a density of 2 × 105 cells per well. Media were collected after overnight culture and centrifuged at 2000 × g for 5 min at 4 °C to remove cell debris. Culture supernatants and mice organ extracts (the lung, liver, and spleen) were assayed for TNF-α using the mouse TNF-alpha Quantikine ELISA Kit from R&D Systems (MTA00B, Minneapolis, MN, USA) according to the manufacturer’s instructions.

Immunofluorescence and analysis

For LDs quantification, infected cells were fixed with 4% paraformaldehyde for 15 min and then permeabilized with 0.25% Triton X-100 (Sigma-Aldrich) for 10 min. Next, cells were incubated with BODIPY 493/503 (D3922, Molecular Probes, Eugene, OR, USA), according to the manufacturer’s instructions. Nuclei were stained with 4′,6-diamidino-2-phenylindole (D9542, Sigma-Aldrich) for 5 min at room temperature. Immunofluorescence images were observed and analyzed using the confocal laser microscope (TCS SP8, Leica Microsystems, Wetzlar, Germany) and Image J software (National Institutes of Health, Bethesda, MD, USA).

To verify the LDs volume and mass after hvKp infection, subcultured macrophages in a glass-bottom TomoDish were treated with hvKp for 1 h. After washing with PBS (and with gentamicin), the cells in each group were incubated for an additional 4 h in a medium. All experiments were performed in a TomoChamber (Tomocube, Daejeon, Korea) maintained at 37 °C using humidified 5% CO2. Based on the results of RI distribution in a single cell (n = 5/group), the quantitative changes of LDs volume and mass in each group were determined and monitored.

Triglycerides (TGs) level measurements

According to the manufacturer’s instructions, levels of TGs in macrophages lysate were measured using EZ-Triglyceride Quantification Assay kits (DG-TGC100, DoGenBio, Seoul, Korea). Briefly, RAW264.7 cells were cultured and infected with hvKp. Then, the cell lysates (50 µl) for each sample were transferred into a 96-well plate and incubated with the triglyceride reaction mixture (50 µl) at room temperature for 30 min in a dark room. TGs levels in the cells were determined by measuring the Fluorometric (535 nm / 595 nm) using the Synergy/HTX (BioTek instrument, Inc).

Animal experiments

In this study, wild-type male C57BL/6 mice at 8–9 weeks old were purchased from Samtako BioKorea Co. (Osan, Korea). Mice were kept in a specific pathogen-free environment with a 12-h light/dark cycle at 23–25 °C and humidity of 35-75% and received enriched water and ad libitum feeding. All mice were adapted to this environment for 1 week. The mice were randomly assigned to three groups: the PBS control group, hvKp group, and combined treatment group with A922500 + hvKp, each consisting of five mice. For in vivo experiments, mice were infected with an i.p. or i.n. administration of hvKp suspension (1 × 103 CFU suspended in 1 ml or 25 µl sterile PBS), respectively. Treatment with A922500 was administered i.p. at a dose of 3 mg/kg/day, starting one day before infection. The same dose was given once daily for the remaining days throughout the experiment. Control mice were i.p. administered with an equal volume of sterile PBS. Mice were sacrificed 24 h after hvKp injection to harvest organs. The lung, liver, and spleen tissues were homogenized and used for RNA, ELISA, and CFU preparation. All animals were maintained under barrier conditions in a biohazard animal room at the School of Medicine, Keimyung University, Daegu, Korea.

Survival analysis

Mice (5 mice in each group) were treated as described above and closely monitored every day. Survival and body weight rates were measured continuously for 7 days in each group and recorded every 24 h.

Histology

For histopathology, lungs, livers, and spleens from hvKp group or A922500 + hvKp group mice (4 mice in each group) were harvested after 48 h. Tissue samples were fixed in 10% formalin and then they were embedded in paraffin wax. Paraffin sections of 4 μm thickness were cut and were stained with hematoxylin and eosin for light microscopic examination. Whole fields of tissue were scanned to determine the inflamed areas in the lungs and white pulp areas per red pulp in the spleens from each mouse. The number of neutrophils per 0.16 mm2 in the livers from each mouse was counted across eight sections with every eight views to obtain a semi-quantitative estimation.

Ethics statements

This study was approved by the Institutional Research and Ethics Committee at Keimyung University School of Medicine (approval number: KM-2023-22R1) and Chungnam National University College of Medicine (approval number: 202109 A-CNU-180). All animal experiments were performed in accordance with the guidelines of the Korean Food and Drug Administration.

Statistical analysis

Data are presented as mean ± standard deviation and were obtained from three independent experiments. The Student t-test or analysis of variance was used to analyze the data. Statistical analyses were performed, and graphs were made using GraphPad Prism 7.0 software for Windows (GraphPad Software Inc., La Jolla, CA, USA). P-values < 0.05, 0.01, and 0.001 were considered statistically significant.