All procedures were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center (UT Southwestern), an AAALAC-accredited facility. C57BL/6 breeders were obtained from Jackson Laboratories and maintained at UT Southwestern. Both male and female C57BL6/J mice were used in these studies. Animals were maintained under controlled environmental conditions, 12-h light-dark cycles, and provided with food and water ad-libitum.

Research grade recombinant self-complimentary rAAV9/CBh-eGFP-SpA [18] was manufactured at the University of North Carolina-Chapel Hill (Chapel Hill, NC, USA) by triple transfection of HEK293 suspension cells and purified with iodixanol gradient followed by ion exchange chromatography. Purified virus was dialyzed in 350 mM NaCl & 5% D-sorbitol in PBS (vehicle). rAAV vector genome was quantified by qPCR and silver stain gel (Supplemental Material). The same viral vector lot was used in all animals.

At P10, P14, P21, or P90 un-anesthetized mice were randomly assigned to an injection group and received a fixed volume of 5 μL (1e11 vg total) freehand, single bolus intrathecal lumbar puncture injection of the vector or vehicle as previously described [19]. Study 1 animals were all males to exclude sex as a variable. Study 2 animals included both males and females to assess sex differences and injection groups were balanced between males and females (Supplemental Table 1). At 3 weeks post injection, mice were deeply anesthetized with isoflurane and perfused with PBS-heparin. All tissues used for histology were fixed at room temperature for 48 h in 10% formalin. After fixation, tissues used for frozen sectioning were moved to a sucrose gradient (10%, 20%, 30%) for 24 h in each sucrose solution. Tissues for paraffin embedding were moved to 70% ethanol. Tissues collected for biodistribution were immediately frozen on dry ice and stored at –80 °C.

For Study 1 immunohistochemical (IHC) analysis, tissues from 3 to 4 mice per age-injection group were sectioned coronally at 30 micron using a frozen microtome, and every 12th section was collected in a well. Sections from a single well were blocked in hydrogen peroxide for 30 min, then in 10% goat serum for 1 h, and incubated in anti-GFP (1:2000) (Millipore, St. Louis, MO, USA, Cat#: AB3080) overnight at 4 °C. Tissues were then incubated with biotinylated anti-rabbit secondary antibody (1:1000) (Vector Labs, Newark, CA, USA, Cat#: BA-1000) for one hour and staining visualized using a Vecta stain ABC HRP Kit (Vector Lab, Newark, CA, USA, Cat#: PK-6100) and DAB kit (Vector Labs, Newark, CA, USA, Cat#: NC9276270). Tissues were mounted onto super frost plus slides, dried for 24–48 h, dehydrated, and cover slipped using poly-mount xylene (Polscience Inc., Warrington, PA, USA, Cat#: 24176120). Representative sections were selected for each animal that were.

For Study 2 immunofluorescence (IF) analysis, the brain was cut down the midline and the right half was processed, paraffin embedded, and microtome sectioned sagittally at 5 micron thickness by the UT Southwestern Histopathology Core. Sections were deparaffinized, rehydrated, and antigen retrieval performed with an antigen masking solution of citric acid. Following blocking with goat serum, sections were incubated in primary antibodies; anti-GFP (1:500) (Aves Labs, Davis, CA, USA, Cat# GFP-1020), anti-NeuN (1:400) (Millipore, St. Louis, MO, USA, Cat#: MAB377), and anti-S100B (1:250) (ABCAM, AB41548) overnight at 4 °C. Tissues were then placed in secondary Alexa Fluor 488 (Invitrogen, A32931), 594 (Invitrogen, Waltham, MA, USA, Cat#: A11005), and 647 (Invitrogen, Waltham, MA, USA, Cat#: A27040), all at (1:400) for one hour. DAPI (0.5 ng/µL) was applied for 10 min and slides were covered slipped with aqua polymount (Polscience Inc., Warrington, PA, USA, Cat#: 18606-20).

Images were captured at 20X on a Zeiss Axioscan Z1 for fluorescence images and at 20X on a Hamamatsu Nanozoomer 2.0 HT or 40X on a Hamamatsu Nanozoomer S60 for light microscopy images at UT Southwestern’s Whole Brain Microscopy Core facilities. GFP positivity of light and fluorescence microscopy were quantified using the percent pixel count algorithm in HALO Imaging Analysis Platform (Halo2.2. Indica Labs, Albuquerque, NM, USA). Regions traced and analyzed were cortex, hippocampus, thalamus/hypothalamus, brainstem, and cerebellum. Thresholds for each stain were set using positive and negative control images, and the same analysis setting was applied to all images in each analysis group. For each region of interest, positive staining is reported as a percentage of the analyzed area. For spinal cord, 5 sections of cervical, thoracic, and lumber cord were quantified and averaged per region. One of the five animals assessed for brain IHC from Study 1, P21 group was excluded as the injection procedure was deemed not successful based on low GFP expression in the brain.

GFP and S100B co-staining was analyzed in cortex and hippocampus using the Object Colocalization Module in HALO. The percent astrocyte transduction was calculated by dividing the percent of GFP and S100B double positivity by total percent S100B positivity for each region of interest. To determine the number of transduced neurons, two blinded scorers performed hand counts of total neurons (number of NeuN+ cells) and transduced neurons (number of NeuN+ and GFP+ cells) using 10X images. To calculate the percent of transduced neurons, the number of NeuN+ and GFP+ cells were divided by the total number of NeuN+ cells and multiplied by 100. The values from each scorer were averaged together for the final value.

Tissues were homogenized using QIAGEN’s Tissuelyser II (Qiagen, Hilden, Germany, Cat#: 85300) and genomic DNA was isolated from frozen tissues using QIAGEN’s QIACube HT (Qiagen, Hilden, Germany, Cat#: 9001896) per manufacturer’s QIAamp 96 DNA QIACube HT Kit protocol specifications (Qiagen, Hilden, Germany, Cat#: 51331). DNA was quantified by qPCR using THERMO’s 2X PowerUp SYBR Green Master Mix and the custom primer set, Fwd- GGCCGACAAGCAGAAGAACG and Rev- CGAACTCCAGCAGGACCAT (Sigma, St. Louis, MO, USA, Cat#: VC00021), on an Applied Biosciences StepOne Plus qPCR Thermocycler. Data is reported as the number of double-stranded GFP DNA molecules per two double-stranded copies of mouse GAPDH (Biorad, Hercules, CA, USA, Cat#: 10025636), which is the number of vector DNA copies per diploid mouse genome.

One-way ANOVA with Tukey’s multiple comparison was used to assess histological quantification and biodistribution. No sex differences were observed in GFP transduction in Study 2 animals, and data from males and females were combined to increase power. Statistical significance was set at p < 0.05. Statistical analysis and graphing was done using GraphPad Prism software (v10.2.1; GraphPad Software, Boston, MA, USA). Values are expressed as mean ± SD. Outliers were removed from vector biodistribution analysis if data points were above Q3 + 1.5 • Interquartile Range (IQR) or below Q1-1.5 • IQR [20].