Ethics statementsHuman participants

S. aureus strains were obtained from adults 22–44 years of age in the CF program at Yale University, from children 0.5–2 years of age in the CF program at Seattle Children’s hospital and from a longitudinal collection from a single adult in the CF program at the University Hospital of Münster, all as part of routine care. None of the CF patients studied were under CF transmembrane conductance regulator modulator therapy (for example, Kaleydeco, Orkambi).

Bacterial strains

The bacterial strains used in this study are shown in Supplementary Table 4. All strains were grown at 37 °C on LB plates supplemented with 1% agar; LB broth shaking, with the exception of Newman c:adsA in/on LB + 10 mg l−1 chloramphenicol; USA300 c:adsA in/on LB + 5 μg ml−1 tetracycline; or ccpA::Tn, ccpE::Tn, putP::Tn in/on LB + 5 μg ml−1 erythromycin (Nebraska Transposon Mutant Library). For the experiments requiring supplementation with ATP, AMP, adenosine, proline, collagen, glycine, hydroxyproline or ornithine, the medium was pH corrected to 7.0 before filter sterilization using 0.20 μm filters. Inoculum was estimated on the basis of an optical density of 600 nm (OD600) and verified by serial dilution plating.

Mouse experiments

CD57/BL6 and 129S6/SvEvTac mice 8–10 weeks old were purchased from Jackson Laboratories and Taconic, respectively, and housed in a humidity-controlled facility at 18–23 °C and 12 h light/dark cycles. All animal studies were approved (Columbia Institutional Animal Care and Use Committee Protocol AABE8600) and performed in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH), the Animal Welfare Act and US federal law. Two transgenic strains were utilized: GFP FoxP3 DTR (stock number 016958) with background (stock number 005304) and CD73−/− (stock number 018986) with background (stock number 000664). Each in vivo and ex vivo experiment was performed using an equal ratio of male to female animals. Sex was not expected to influence results. Animals were randomly assigned to cages, and their health was routinely monitored by an Institutional Animal Care and Use Committee veterinarian.

Methods detailsMaterials and resources

A comprehensive list of materials and resources has been provided in Supplementary Table 4.

Cloning of USA300 adsA mutant

The adsA mutant in strain background USA300 was generated using the pIMAY protocol21,51. A fully synthetic 1,200 bp double-stranded DNA fragment was designed and ordered from Invitrogen (GeneArt). This DNA fragment contained the following features (from 5′ to 3′): SphI and BamHI restriction sites, a Pxyl/tet promoter, a ribosome-binding site, a codon-optimized pheS* gene, and KpnI and BglII restriction sites. The synthetic DNA was cloned in the topoisomerase vector pCR8 and transformed into XL1-Blue cells, resulting in strain ANG3944. The resulting plasmid pCR8-pheS* was found to have two base exchanges in the 10 promoter region, altering the optimal sequence TATAAT to CTTAAT (Pxyl/tet*). The Pxyl/tet* pheS* construct was sub-cloned from pCR8-pheS* via the SphI and BglII restriction sites into pIMAY [7], and the resulting plasmid pIMAY* was introduced into XL1-Blue, creating strain ANG4005. pIMAY* was then shuttled through IM08B [18], yielding strain ANG5002, and further used to transform S. aureus RN4220 and LAC*, creating strains RN4220 pIMAY* (ANG5079) and LAC* pIMAY* (ANG5080), respectively.

Plasmid pIMAY*-DmgtE was constructed by amplifying 1,000 base pairs of genomic DNA upstream and downstream of mgtE from S. aureus LAC* (ANG1575) chromosomal DNA using primer pairs P2374 (TATA CCCGGG AATGT- TAATT CAATACAATA CCGTGTAGC)/P2375 (AAAT- GATGTA GCACGCTCTT TTTCATCTGT GTTCATTGAC) and P2376 (GAAAAAGAGC GTGCTA- CATC ATTTATGGCT TACTTAATTT AAG)/P2377 (ACGT GAATTC TTGAAATGAT AAATGCAACG ATTAAAATCG), which were then spliced together using the primer pair P2374/P2377. This fusion construct contained the first and last 30 bases of mgtE and thus created a non-functional truncated open reading frame with flanking regions. The spliced DNA was cut with XmaI and EcoRI, ligated into pIMAY* (ANG5002) cut with the same enzymes and introduced into XL1-Blue, yielding strain ANG5081. The plasmid was subsequently introduced into IM08B to create strain ANG5082, and the plasmid isolated from this strain was introduced into S. aureus strains RN4220 [36] and LAC*. Two colonies each were selected, yielding strains ANG5083–86, and used in the allelic exchange procedure.

For the construction of the complementation plasmid piTET-mgtE, the mgtE gene, including its ribosome-binding site, were amplified using primers P2384 (CGATCCTAGG ACAGGGGGTGTAAGTATGTCAATGAACAC) and P2385 (AAGCAGATCT TTAAATTAAGTAAGCCA TAAATGATGTAGC). The PCR product was cut with AvrII and BglII and ligated with plasmid piTET (ANG284), which had been cut with the same enzyme. The resulting plasmid was recovered in Escherichia coli XL1-Blue cells, yielding strain ANG4144. The plasmid was then shuttled through IM08B, creating strain ANG4155, and used to transform one of the LAC* DmgtE deletion strains (ANG5091), resulting in the construction of the complementation strain LAC*DmgtE piTET-mgtE (ANG5288). In addition, the empty vector piTET isolated from strain ANG3928 was introduced into the mgtE mutant strain LAC*DmgtE 581 (ANG5091), (ANG5287) creating strain LAC*DmgtE piTET.

RNA-sequencing of S. aureus Newman WT and ΔadsA

S. aureus WT and ΔadsA were grown in LB with or without 100 μM proline to late exponential phase. Bacterial pellets were incubated in a cell wall lysis mixture TE buffer at pH 8 (30 mM Tris, 1 mM EDTA, 15 mg ml−1 and 200 μg ml−1 proteinase K) containing mutanolysin, lysostaphin and lysozyme at 37 °C for 30 min. TRK lysis buffer Total RNA lysis Kit (Omega #PRQ21) and 70% ethanol were added to each sample, before transferring to E.Z.N.A RNA isolation columns. RNA was isolated following the manufacturer’s instructions, and DNA was selectively degraded using the DNA-free DNA removal kit. The RNA was precipitated with 0.1 volume 3 M sodium acetate (Thermo Fisher #S209) and 3 volumes of 100% ethanol, recovered by centrifugation and washed with ice-cold 70% ethanol. A ribosomal RNA-depleted complementary DNA library was prepared according to the manufacturer’s instructions using the Universal Prokaryotic RNA-Seq Prokaryotic AnyDeplete kit (NuGEN #0363-32) and sequenced with Illumina HiSeq. Raw base calls were converted to fatsq files using Bcl2fastqs. Filtered reads were aligned to the Newman (Refseq NC_009641.1) reference genome using STAR-Aligner v2.7.3a. The mapped reads were annotated for read groups and marked for duplicates using the Picard tools v2.22.3. The raw counts were quantified using Subreads:FeatureCounts v1.6.3 and processed for differential gene expression using DEseq2 in R v3.5.3. Analysis of sequencing for clinical isolates was performed by Windmüller and colleagues. Briefly, data were stratified into ≥2f, ≥4 f, ≥8 f and genes that were either not expressed in both isolates or not present on the genome level in both isolates. To exclude low abundant transcripts, a threshold of less than 3 reads per gene was used (accession number GSE268637).

Mouse lung infection

Mice were anaesthetized with a 20:1 ketamine xylazine formulation infected intranasally with 1 × 108 colony-forming units (c.f.u.) of the specified S. aureus strain. Bacteria were delivered in 50 μl PBS, and sterile PBS was used as control (vehicle). All mice were killed 72 h post infection for BAL fluid collection and lung tissue processing. Lung tissue was homogenized through 40–70 μm cell strainers. Colony-forming units were determined by serially diluting aliquots of the BAL and of lung homogenates, which were plated on LB agar plates (with the exception of Newman c::adsA on LB + 10 mg l−1 chloramphenicol; USA300 c::adsA on LB + 5 μg ml−1 tetracycline; ccpA::Tn, ccpE::Tn and putP::Tn on LB + 5 μg ml−1 erythromycin). The remaining BAL was spun and stored for cytokine and metabolomic analysis. BAL and lung cells were treated with a hypotonic lysis solution for elimination of red blood cells, counted and prepared for fluorescence-activated cell sorting (FACS) as described below.

In vivo Treg cell depletion

GFP FoxP3 DTR (strain number B6.129(Cg)-Foxp3tm3(DTR/GFP)Ayr/J; stock number 016958) allows for depletion of FoxP3+ cells upon daily administration of diphtheria toxin. Mice were injected intraperitoneally with 50 μg kg−1 diphtheria toxin resuspended in sterile water once a day for 5 days. Mice were inoculated on the third day and processed on the sixth day as indicated above.

Untargeted metabolomic analysis

Aliquots of BAL supernatants were mixed in equal volume (v/v) with methanol and stored at −80 °C. Metabolites were identified and quantified by high-resolution mass spectrometry. Sample runs were performed on a Q Exactive HF Hybrid Quadrupole-Orbitrap Mass Spectrometer (Thermo Fisher) coupled to a Vanquish UHPLC System (Thermo Fisher). Chromatographic separation was achieved on a Syncronis HILIC UHPLC column (2.1 mm × 100 mm × 1.7 µm, Thermo Fisher) using a binary solvent system at a flow rate of 600 µl min−1. Solvent A, 20 mM ammonium formate at pH 3.0 in mass spectrometry grade H2O; solvent B, mass spectrometry grade acetonitrile with 0.1% formic acid (%v/v). A sample injection volume of 2 μl was used. The mass spectrometer was run in negative full-scan mode at a resolution of 240,000 scanning from 50 to 750 m/z. Metabolites were identified using the known chromatographic retention times of standards, and metabolite signals were quantified using E-Maven v0.10.0.

Pathway analyses

Following bulk RNA sequencing, bacterial pathways were identified using the National Institutes of Allergy and Infectious Diseases (NIAID)/NIH free Database for Annotation, Visualization and Integrated Discovery. The use of the tool relies on the identification of the bacterial species and genus and specific gene coding. In brief, a comprehensive rubric of NCTC8325 codes in the SAOUHSC ortholog format matching the sequencing locus discovery was assembled manually using the AureoWiki free online repository unique to S. aureus. The input of the codes in Database for Annotation, Visualization and Integrated Discovery generated unbiased functional annotations and pathway suggestions as well as a list of corresponding gene counts per pathway.

Following untargeted metabolomics of BAL fluid, host pathways were identified using the Ingenuity Pathway Analysis bioinformatic software (QIAGEN). In brief, a rubric of the Kyoto Encyclopedia of Genes and Genomes metabolite codes matching the macromolecular discovery was assembled. Data were paired for t-Student comparison and averaged to a single value for the generation of a fold change (log2). The input of the above in Ingenuity Pathway Analysis generated unbiased pathway suggestions as well as significance with respect to cumulative pathway P values and relative fold change.

Cytokine analysis

Aliquots of BAL supernatants were stored at −80 °C. Cytokine concentrations in BAL supernatants were quantified with the Mouse Cytokine Proinflammatory Focused M31-plex Discovery Assay (Eve Technologies), which quantifies eotaxin, G-CSF, GM-CSF, IFNγ, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-12p40, IL-12p70, IL-13, IL-15, IL-17A, IP-10, KC, LIF, LIX, MCP-1, M-CSF, MIG, MIP-1α, MIP-1β, MIP-2, RANTES, TNFα and VEGF-A; TGFβ 3-plex, which quantifies TGFβ1, TGFβ2 and TGFβ3; and MMP 5-plex, which quantifies MMP-2, MMP-3, MMP-8, proMMP-9 and MMP-12, using a bead-based multiplexing technology also known as addressable laser bead immunoassay.

FACS

BAL and lung cells were treated with a hypotonic lysis solution for elimination of red blood cells and stained with fluorescent antibodies as follows. All antibodies were purchased on BioLegend unless otherwise indicated—lymphocytes: live/dead, CD45, CD4, CD8, CD25, FoxP3, CD39 and CD73; granulocytes and leukocytes: SiglecF, CD11b, CD11c, MHCII, LY6G, LY6C, CD39 and CD73; fibroblasts: live/dead, CD45, Dump gate (CD31, EPCAM, TER119, THY 1.2, CD146), SCA-1 and CD140a. Gating strategies are shown in Supplementary Figure 4.

All antibodies were used at a dilution of 1:200 with the exception of CD45 and FoxP3 (1:100) and CD25 (1:50). All dilutions were performed in PBS, and cells were stained for 1 h at 4 °C. For lymphocytes, after washing, the cells were fixed, permeabilized and intracellularly stained with a monoclonal anti-FoxP3 antibody in permeabilization buffer for 30 min at room temperature. After a final wash, the cells were stored in 2% paraformaldehyde until analysis on the BD LSRII (BD Biosciences) using FACSDiva v9. Flow cytometry was analysed with FlowJo v10.

Primary fibroblast isolation

Immediately after euthanasia of the experimental animal, the chest cavity was opened and the lungs flushed with PBS through the heart from the right ventricle. The lungs were both inflated and immersed in dispase (~0.9 ml, 50 U ml−1), incubated at room temperature for 20 min and isolated from surrounding structures. Lobes were chopped mechanically and incubated at 37 °C for 10 min in MEM + DNase to complete digestion. The mixed cells were filtered through 100 µm and 40 µm cup filters, and fibroblasts were removed from the suspension by three successive adherence steps on plastic. With respect to other cells, fibroblast adhesion is faster and facilitated by the continuous and sequential generation of filopodial structures containing integrins52. Moreover, adhesion is facilitated by the treated plasma of cell culture plates, which permits obtaining a consistent cell attachment and growth. Primary fibroblasts are washed three times with 1× PBS and incubated with Dulbecco's modified Eagle's medium (DMEM) 10% fetal bovine serum (FBS) and antibiotics.

Primary murine fibroblast immunostaining and imaging

Primary fibroblasts were fixed with 4% paraformaldehyde for 10–20 min at room temperature and washed three times with PBS for 5 min. The cells were permeabilized with 0.25% Triton X-100/PBS for 30 min at room temperature followed by blocking in 10% donkey serum diluted in PBS for 1 h. Vimentin primary antibody was diluted (1:400) in 5% donkey serum in PBS and incubated at 4 °C overnight. The following day, cells were washed three times with PBS before applying the secondary antibody (1:400) for 1 h incubation at room temperature. Following secondary incubation, sections were washed three times for 10 min with PBS and finally stained with DAPI (1:1,000) for 10 min at room temperature. PenStrep (1%) was added in 200 μl PBS before imaging with a motorized Leica Stellaris DMi8 (Leica Microsystems) inverted confocal microscope. Positive cells were counted over total number of cells. LasX v1.4.5 was used for fibroblast imaging.

Primary murine fibroblast infection time course

Primary fibroblasts were isolated from mouse lungs as described above and incubated in antibiotics for 4–5 days until 70–80% confluency was achieved. Cells were counted and plated (including two extra wells per plate) the day before infection. On the morning of the infection, the two extra wells were counted to determine the multiplicity of infection (MOI). After media change, the cells were infected with bacterial subcultures of WT and ΔadsA Newman strains grown to late exponential phase at a MOI of 10, or treated with PBS control. The infection was allowed to proceed until pre-determined time points. Processing of plates at the selected time points of 2, 24 and 72 h involved retrieving and plating one aliquot of supernatant for c.f.u. counts to determine extracellular multiplication due to collagen consumption. After 1 h incubation at 37 °C in 500 ng ml−1 gentamicin, aliquots of supernatants were collected and stored at −80 °C for protein quantification and RNA isolation before addition of 0.25% trypsin for 9 min at 37 °C. Aliquots of cells were either stored at −80 °C or used to measure cell viability.

Inhibition of collagen synthesis

Halofuginone, a semisynthetic quinazolinone (Collgard Biopharmaceuticals), was reconstituted in DMSO at a stock concentration of 5 mg ml−1.

For in vitro study, inhibition of collagen synthesis in cell culture was achieved via the administration of 0.25 mg ml−1 of halofuginone per well32 once before infection.

For in vivo study, inhibition of collagen synthesis was achieved through the intraperitoneal administration of halofuginone at a dose of 0.1 mg kg−1 in 100 μl of di-water for 3 sequential days, starting from the day of infection33,34. The health of control/uninfected mice was monitored to survey potential effects of the drug or vehicle. Animal weight was recorded every 24 h until euthanasia.

Collagen detection enzyme-linked immunosorbent assay

Collagen was quantified using the Mouse Pro-Collagen alpha 1 enzyme-linked immunosorbent assay (ELISA) kit (abcam) according to manufacturer’s instructions. Briefly, supernatant and cell aliquots from in vitro primary fibroblast infections and from in vivo airway BAL fluid were treated solubilized with chilled 1× Cell Extraction Buffer PTR, incubated on ice for 20 min and centrifuged at 18,000 g for 20 min at 4 °C. Supernatants (50 μl) were transferred to the assay plate along with 50 μl of antibody cocktail (600 μl 10× capture antibody, 600 μl detector antibody and 2.4 ml antibody diluent 5BR) per well and incubated at 400 r.p.m. for 1 h at room temperature. After washing, 100 μl of tetramethylbenzidine (TMB) substrate was added, and the plate was incubated shaking for 10 min in the dark. The addition of 100 μl of stop solution occurred before the endpoint reading at OD 450 nm.

Collagen staining and pathology assessments

Following euthanasia, the mouse was tracheostomized and cannulated. The thorax was opened to facilitate lung expansion upon gentle infusion of formalin-free tissue fixative through the cannula, attached to a 5 ml syringe positioned above the mouse. Lungs were collected en bloc, placed in formalin-free tissue for 24 h, in 70% ethanol for 24 h and prepared in paraffin blocks. Haematoxylin and eosin and Masson’s trichrome staining were performed on 5 μm sections (two sections cut 25 μm apart for each lung) for gross pathology assessment.

In vitro RNA isolation

Bacterial strains Newman WT, Newman ΔadsA and all clinical isolates were grown to the exponential phase and normalized to an OD600 of 1. Bacteria were incubated in RNAprotect cell reagent and TE buffer at pH 8 (30 mM Tris, 1 mM EDTA and 200 μg ml−1 proteinase K) containing mutanolysin, lysostaphin and lysozyme at 37 °C for 30 min. TRK lysis buffer and 70% ethanol were added to each sample, before transferring to E.Z.N.A RNA isolation columns. RNA was isolated following the manufacturer’s instructions, and DNA was selectively degraded using the DNA-free DNA removal kit.

In vivo RNA isolation from mouse lungs

Total RNA (eukaryotic and prokaryotic) was isolated from infected whole mouse lungs added to TRIzol Reagent following the manufacturer’s instructions and homogenized. Aliquots of these samples were stored for immediate reverse transcription to obtain largely eukaryotic cDNA analysis. The remaining sample was depleted of eukaryotic RNA with a MICROBEnrich Kit. The samples were added to binding buffer and capture oligonucleotide mix, incubated at 70 °C for 10 min and 37 °C for 1 h to hybridize prokaryotic RNA with the oligonucleotides. Host RNA was then depleted using OligoMag beads, and enriched prokaryotic RNA was recovered following the manufacturer’s instructions. DNA was selectively degraded using the DNA-free DNA removal kit. Prokaryotic RNA was precipitated using MICROBEnrich Kit as per manufacturer’s instructions.

cDNA synthesis and quantitative real-time PCR

RNA was converted to cDNA using a High-Capacity cDNA Reverse transcription kit and a SimpliAmp thermocycler (Applied Biosystems). Quantitative real-time PCR was performed using the relevant primers and PowerUp SYBR Green PCR Mastermix. All primers used in this study are listed in Supplementary Table 1. The experiment was performed on a StepOnePlus Real-time PCR System (Applied Biosystems) using StepOne v2.3. Data were analysed using the ∆∆CT method. 16S was used as a control housekeeping gene for bacteria, and the Newman strain of S. aureus was included as a wild-type control. GAPDH was used as a control housekeeping gene, and the uninfected hosts were used as controls.

Carbon utilization assays

S. aureus WT, adsA mutants and clinical isolates were grown to the exponential phase and normalized to an OD600 of 2. A stock solution of 2 × 107 bacteria per ml was made in 1× IF-Oa buffer supplemented with 1× Redox Dye Mix H. About 100 μl of this stock solution was added to each well of a BIOLOG PM1 Microplate (BIOLOG) delivering 2 × 106 bacteria. This plate was incubated at 37 °C for 24 h, and absorbance was read at 590 nm on a SpectraMax M2 plate reader.

Growth curves

A U-bottomed, clear 96-well plate was prepared with LB or chemically defined media (CDM), LB or CDM supplemented with 100 µM proline and LB or CDM supplemented with 30–10 µg ml−1 collagen. Each well was inoculated with 2 × 106 bacteria. Absorbance at 600 nm was read every 30 min for 20–50 h on a SpectraMax M2 plate reader. The plate was incubated at 37 °C with shaking before and after every read. Compound are listed in Extended Data Table 5.

Biofilm assays

A flat-bottomed, clear, 96-well plate was prepared with LB or LB with 0.5% glucose (w/v), supplemented with serially diluted, pH-corrected proline. Each well was inoculated with 1.5 × 106 bacteria, and the plate was left to incubate statically overnight at 37 °C. The next morning, absorbance at 600 nm was determined on an Infinite M200 plate reader (Tecan). To stain the biofilm, the supernatant was discarded, the plate was washed and dried, and the biofilm was fixed with 100% methanol, then stained with 1% crystal violet. After discarding the staining solution and washing and drying the plate, the stained biofilm was resuspended in 33% acetic acid. Absorbance at 540 nm was determined on the Infinite M200 plate reader using iControl v1.10.4.

ATP luciferase assays

Bacterial strains were cultured overnight in LB + 100 μM proline or LB alone, standardized to an OD of 1 and subcultured 1:100 with the respective fresh broths for 2 h. In a 96-well plate, an ATP 10-fold serial dilution was used as internal standard control. ATP concentrations were measured as per BacTiter Glo Microbial Cell Viability Assay kit instructions. For extracellular ATP, supernatant was obtained from 100 μl of bacterial culture and mixed with assay reagents for 5 min before reading luminescence on a SpectraMax M2 plate reader. For intracellular ATP, 200 μl of bacterial culture was mixed with 100 μl of ice-cold 1.2 M perchloric acid, incubated on ice for 15 min, and neutralized with 0.72 M KOH and 0.16 M KHCO3.

Extracellular flux analysis

Bacterial cultures were grown overnight and subcultured. The XFe24 sensor cartridge was calibrated as per the manufacturer’s instructions overnight at 37 °C without CO2. About 500 μl of XF base medium supplemented with 2 mM glutamine was added to each well of a Seahorse XF24 well plate and inoculated with 2 × 106 bacteria for a 1 h incubation at 37 °C. The OCR and ECAR were measured on a Seahorse XFe24 Analyzer (Agilent Technologies) using Seahorse Wave Desktop v2.6.0. Proline was added at a final concentration of 100 μM at the three time points indicated.

In silico bioinformatic identification of ccpA and ccpE binding motifs

De novo assembly of the sequenced airway isolates, A2001 and T2015, was performed using Shovill (v. 1.1.0) (https://github.com/tseemann/shovill). Following the completion of assembly, the genomes were identified as S. aureus using Mash (v. 2.1)53. Assembled genomes were annotated using Prokka (v.1.14.6)54. The atopic dermatitis genomes used in comparison—AD2 (GCF_011319675.1) and AD8 (GCF_011319565.1)—were downloaded from RefSeq database in the National Center for Biotechnology Information (NCBI) using ncbi-datasets (v. 14.6.0)55. Basic Local Alignment Search Tool (Blastn) (v. 2.13.0) was then used to confirm the presence of the genes of interest in each of these five genomes56,57,58. After confirming the presence of each of these genes, samtools (v. 1.16.1) was used to extract each gene59. In extracting each gene, 1,000 base pairs upstream from the start of the gene and 1,000 base pairs downstream from the end of the gene were included. Using a custom script, the extracted regions for each genome were evaluated for matches to the cis-acting sequence called catabolite responsive element (cre) sites. Taking into consideration that diverse cre sites have been published39,60,61,62, we used two candidate motifs and allowed up to two mismatches. One of the cre motifs that was searched for was WTGNAANCGNWNNCW, where W represents A or T, and N represents any nucleotide44. The other candidate sequence that was used in the custom script was TGTAAA-Yx-TTTACA, where N represents any base and ranges between 0 and 40 nucleotides45. The custom script reported the sequence that was identified, the motif that the sequence matched, the location of the sequence in relation to the start of the gene of interest and the number of substitutions (that is, 1 substitution, 2 substitutions or exact match). The best match was to be the sequence closest to the start of the gene of interest, with the least number of mismatches. We then checked for nonsynonymous mutations in ccpA and ccpE, in the four clinical isolates. A protein alignment was performed using Snippy (v. 4.6.0) (https://github.com/tseemann/snippy). The gene sequences of ccpA (region 1813146.1814135) and ccpE (region 724466.725332) from strain Newman (Refseq NC_009641.1) were used as the reference for each alignment. SnpEff (v. 4.3.0) was then used to analyse the effect of each single-nucleotide polymorphism on the protein sequence63. The alignments were visualized using snipit (v. 1.1.2), with the respective gene from strain Newman as the reference (https://github.com/aineniamh/snipit).

Bacterial luciferase reporter plasmid

To construct pIMK1-LUX, the Listeria phage integrase vector pIMK64 was digested with SphI/BglII to excise the PSA integrase and replace it with the PCR-amplified (IM1241/IM1242) low copy number pSK41 replicon from pLOW65, yielding pIMK1. Vectors pIMK1 and pPL2lux were then digested with SalI/PstI, and the gel-extracted pIMK1 backbone ligated to the bacterial luciferase operon from pPL2lux. The vector pIMK1-LUX produces exact promoter fusions which can be cloned into the SalI/SwaI digested vector, as described previously64. Promoters for adsA (IM1793/IM1794), citB (IM1785/IM1786) and pckA (IM1787/IM1788) were amplified from S. aureus strain JE2 genomic DNA. The amplimers were digested with SalI, gel extracted and cloned into the pIMK1-LUX double digested vector. Plasmids isolated from IM08B66 were transformed into S. aureus JE2, JE2 ccpA::Tn or JE2 ccpE::Tn and selected on brain heart infusion agar containing 50 µg ml−1 kanamycin. An overnight 5 ml LB culture containing kanamycin was diluted 1:100 in fresh LB containing kanamycin. The culture was then dispensed in triplicate (200 µl) black/clear bottom 96-well plates (PhenoPlate 96-well microplate, Perkinelmer). The plates were sealed with MicroAmp Optical Adhesive Film (Thermo Fisher) and incubated at 37 °C with dual orbital shaking at 300 r.p.m. (Clariostar Plus, BMG). Every 10 min the plate was read at OD600, and light emission (1 s exposure) collected over an 8 h period. Primers are listed in Supplementary Table 1.

Colony PCR

Transposon mutants from the Nebraska Transposon Mutant Library were confirmed via colony PCR. Primers were generated manually and consisted of the first and last 20 bp of the genes of interest. Agarose gels (1%) in 1× Tris–acetate–EDTA buffer were cast after addition of ethidium bromide and allowed to solidify. LB agar + erythromycin plates were streaked with mutants of interest (ccpA::Tn, ccpE::Tn, putP::Tn) and grown overnight. A minimum of 10 single colonies were picked per transposon mutant, and a minimum of 3 for the isogenic WT JE2, both to be resuspended in 25 μl NON-DEPC nuclease-free water. A Go-Taq master mix is prepared (12.5 μl Go Taq, 1 μl forward primer, 1 μl reverse primer, 5 μl emulsified colony, 5.5 μl nuclease-free water) and set at an enzyme/oligonucleotide-dependent thermal cycle (Applied Biosystems) as indicated in the Extended Data. Upon the completion of the cycle, the samples were loaded in the solidified agar gel soaked in an electrophoresis chamber with 1× Tris–acetate–EDTA at room temperature. Gel was run at 140 V for 20 min and imaged with a chemiluminescent detection imager (ProteinSimple). Emulsified colonies of confirmed mutants were streaked and incubated overnight.

In vivo skin infection

Mice were infected intradermally on the shaved back with 1 × 107 c.f.u. of S. aureus Newman WT or adsA mutant. Bacteria were delivered in 100 μl PBS, and sterile PBS was used for an uninfected control (vehicle). Lesion size was measured daily, and mice were killed after 6 days for tissue collection and processing. Skin tissue was collected via 5 mm punch biopsy in the centre of the infected lesion and homogenized through a 40 μm cell strainer. Aliquots of the homogenates were serially diluted and plated on LB agar (±antibiotics if needed) plates to determine c.f.u. counts. Separate aliquots were added to TRK lysis buffer and frozen for later host RNA isolation.

Cloning of the ΔadsAΔputPΔproT USA300 mutant

The putP and proT genes were deleted (between the start and stop codon) from S. aureus LAC or LACΔadsA by allelic exchange, as described in ref. 67. For the deletion substrate, gBlocks for putP (screening primers IM1789/IM1790) and proT (screening primers IM1791/IM1792) were synthesized by Integrated DNA Technologies, cloned into pIMAY-Z by SLiCE and transformed into E. coli IM08B. The genes were deleted sequentially, yielding LACΔproTΔputP and LAC ΔadsAΔproTΔputP and genome validated by Oxford nanopore sequencing68.

BMDM killing assay

Bone marrow was isolated from mouse femurs and tibias spun at 500 g for 6 min and resuspended in ammonium chloride potassium (ACK) lysis buffer for 5 min at room temperature. After lysis buffer inactivation, the cells were plated and differentiated in DMEM with penicillin–streptomycin in the presence of 20 ng ml−1 of murine macrophage colony stimulating factor (M-CSF) for 5 to 6 days (Peprotech). Newly differentiated BMDMs were seeded at 0.3 × 106 cells per ml in DMEM supplemented with 1% FBS. BMDMs were infected at an MOI of 10 for 60 min and washed. Fresh DMEM containing 1% FBS and 50 μg ml−1 gentamicin (Sigma) was then added until the desired time point. The cells were washed, detached using TrypLE Express (Life Technologies), serially diluted and plated on LB agar at 2, 4 and 6 h post infection. Cell viability was determined by trypan blue (Life Technologies) staining assay.

Quantification and statistical analysis

Experiments in this study were not performed in a blinded fashion except for the histopathology qualitative score assessments. Animal assignment to control or experimental groups was randomized. No statistical methods were used to pre-determine sample sizes, but our sample sizes are similar to those reported in previous publications from our laboratory. All analyses and graphs were performed using the GraphPad Prism 9 software. Values defined as n represent individual experiments, and graphed data points represent total biological replicates (please note that some replicates with value 0 will not be visible on logarithmic scale). Values in graphs are shown as average ± s.e.m., and data were assumed to follow a normal distribution. For comparison between average values for more than two groups, we performed one-way analysis of variance (ANOVA) with a multiple posteriori comparison (Tukey’s multiple comparisons or Dunnett’s multiple comparisons). When studying two or more groups along time, data were analysed using two-way ANOVA with a multiple posteriori comparison. Differences between two groups were analysed using a Student t-test with Kolmogorov–Smirnov test. Differences were considered significant when at least a P value under 0.05 (*P < 0.05) was obtained (**P < 0.01; ***P < 0.001; ****P < 0.0001). Statistical details of experiments are indicated in each figure legend. Data distribution was assumed to be normal. No data points were excluded.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.