Cell culture and transfection

Ault hippocampal neural stem cells (NSCs) were purchased from Merck-Millipore (SCR022). The cells proliferated in neural stem cell base medium (SCM003, Millipore) containing fibroblast growth factor 2 (FGF2, 20 ng/mL, Millipore) on the dishes coated with 50 µg/ml poly-L-ornithine and 10 µg/ml fibronectin (Sigma-Aldrich). Adding 1 µM retinoic acid (Sigma-Aldrich) plus 5 µM forskolin (Sigma-Aldrich) into base medium to induce neuron-specific differentiation of NSCs, and adding 50 ng/ml LIF (Merck Millipore) plus 50 ng/ml BMP-2 (R&D Systems) into base medium to induce astrocyte-specific differentiation of NSCs. They all need to be cultivated for seven days.

The experimental plasmid construction and lentivirus packaging were provided by Shanghai Genechem Co., Ltd. These were the target sequences of short hairpin RNAs (shRNAs): Sh-Alkbh3, 5′-TGAAGATACCATTGGATCA-3′; Sh-Alkbh3, 5′-CAACCAAGACTTACAGCAT-3′, Sh-Mmp15, 5′-GCACTGACCTGCATGGAATCA-3′, Sh-Mmp15, 5′-GGATGGACACTGACAACTTCC-3′. For Alkbh3 overexpression, the sequences encoding Alkbh3 was inserted into the lentivirus which consisted of Ubi-MCS-SV40-EGFP-IRES-puro-GV367 vector. RISPR/Cas9 system was used into lentivirus vector expressing Alkbh3, designing single guide RNAs (sgRNAs) whose sequence was GCAACTACCATCTGACCTTCA. After the preparation of all lentiviruses, the optimal virus concentration of transfected cells was determined by pre-experiment. Lentivirus transfection and puromycin (1 µg/ml) screening generated stable knockdown and overexpression lines.

Animals and virus injection

The experimental protocol was approved by the Animal Ethics Committee of Guangzhou Medical University, and the experiment was conducted in accordance with the Guidelines for Animal Protection and Use in China. Wild-type male C57BL/6 mice were pre-adapted to the experimental environment for a week, and were divided into two groups by random number assignment, namely the experimental group and the control group, with eight mice in each group. Alkbh3 retrovirus was injected into the experimental group and vector retrovirus into the control group using brain stereotaxic apparatus. Behavioral experiment and BrdU proliferation experiment could be performed three weeks later.

Alkbh3-specific shRNA (Target Seq1 TGAAGATACCATTGGATCA, Target Seq2 GCCATGAAACACCTTCCTAAT) retroviral particles were obtained from Shanghai Genechem Co., Ltd. 1 µl of retroviral solution with a titer of 2☓108 units/ml was injected at a rate of 0.1 µl/min into the bilateral hippocampus (2.0 mm posterior to the bregma, ± 1.5 mm lateral to the midline, 2.0 mm deep from the top of the skull). After viral injections, the needle was retained for 20 min, and then slowly extracted. The scalps of mice were sutured, marked accordingly, and put back into the cage for follow-up experiments.

Immunohistochemistry and immunofluorescence

For immunohistochemistry, mice brain tissues were fixed with 4% paraformaldehyde, then the brain was dehydrated with 30% sucrose, embedded with OCT compound (SAKURA), and sectioned to 30 μm in freezing microtome before treating with antigen retrieval solution (P0090, Beyotime). For immunofluorescence, the cells spread on the well plate were fixed with 4% paraformaldehyde. The experiments in vitro were independently repeated three times. The following antibodies were used in stained: anti-Alkbh3 (1:400; Novus; NBP2-55419), anti-Mmp15 (1:200; MyBioSource; MBS1753732), anti-GFAP (1:200; Abcam; ab4674), anti-Nestin (1:250; Proteintech; 66259-1-Ig), anti-beta III Tubulin (1:200; Abcam; ab78078), anti-NeuN (1:200; Abcam; ab104224), anti-BrdU (1:200; CST; 5292 S), anti-Doublecortin (1:400; CST; 4604 S).

5-Bromo-2′-deoxyuridine and 5-ethynyl-2′-deoxyuridine labeling

Mice in both groups were intraperitoneally injected with BrdU (Sigma) solution (dosage per 100 mg/kg of mouse body weight) for seven days at a fixed time every day, and the brain could be injected from the eighth day. During BrdU staining, slices were soaked in 2 N HCl at 37℃ for 30 min, then 0.1 M borate buffer was added at pH 8.5 and soaked at room temperature for 10 min. The other steps are basically the same as immunofluorescence. For EdU labeling, cells were treated with kFluor488-EdU method cell proliferation assay kit (KGA331, KeyGEN BioTECH) according to the manufacturer’s protocols. The experiment was performed in triplicate.

Quantitative real-time RT-PCR

Total RNA was extracted from the cells using TRIzol reagent (Invitrogen), followed by reverse transcription using RT reagent kit with gDNA eraser (Takara, RR047A) and real-time PCR analysis using TB Green Premix Ex Taq II (Takara, RR820A). The experiment was performed in triplicate. The primer sequences were as follows: Alkbh3 forward: 5′-TCCAGAGAACGGAGAGTAA-3′: Alkbh3 reverse: 5′-GAGGAATAGGACCTGAGAAG-3′: Mmp15 forward: 5′-GCCTGCCTGGGAACATTAGT-3′: Mmp15 reverse: 5′-ATTGAAGCGCCAGTACCTGT-3′: GAPDH forward: 5′-GCGAGATCCCGCTAACATCA-3′; GAPDH reverse: 5′-CTCGTGGTTCACACCCATCA-3′.

Western blotting

RIPA lysis buffer containing protease inhibitor (KGP702, KeyGEN BioTECH) was added to the cells in the petri dish to recapture the cells, and then collected into Eppendorf tubes, which were crushed on ice by ultrasound and centrifuged to extract the supernatant. According to the molecular weight of the target protein and the corresponding instructions, SDS-PAGE gel configuration kit was used to prepare the concentrated glue and the separation glue of the corresponding concentration. Western blotting was performed as standard protocol. The following antibodies were used in Western blotting: anti-Alkbh3 (1:800; Proteintech; 12292-1-AP), anti-Mmp15 (1:500; Bioworld ; BS7041), anti-β-actin (1:2000; CST; 4970 S), anti-rabbit HRP-linked IgG (1:2000; CST; 7074 S), anti-mouse HRP-linked IgG (1:2000; CST; 7076 S). The experiment was performed in triplicate.

m1A dot blot assay

Total RNA was isolated from petri dishes with the same number of cells using Trizol reagent (Invitrogen). mRNA purification kits (Invitrogen, 61,006) purify mRNA from total RNA. Purified mRNA of the same quality was uniformly spotted on a Nitrocellulose membrane (GE Healthcare; RPN308B). After cross-linking with 254 nm UV, the membrane was blocked with 5% nonfat milk in TBST and then incubated with m1A specific antibody (1:500; abcam; ab208196) at 4℃ overnight. The experiment was performed in triplicate.

m1A-MeRIP-seq and data process

The m1A-IP-Seq service was provided by Supin (Shanghai) Biotechnology Co., LTD. The cultured cells were collected and total RNA was extracted from NSCs group, astrocyte differentiation group and neuronal differentiation group, respectively. After the total RNA samples were inspected and quantified by agarose electrophoresis and Nanodrop, the mRNA was enriched with oligo (dT) magnetic beads (if the RNA was degraded or prokaryotic, it was directly treated with rRNA removal kit). All RNA sequencing libraries are completed by the kit, including the first strand cDNA generated by random primers after RNA fragmentation, the second strand cDNA synthesized by adding dUTP, the double-stranded cDNA end repair, adding A, connecting with Illumina matching splitter, and PCR amplification to obtain the final library: The constructed library was inspected by Agilent 2100, quantified by qPCR, and sequenced by Illumina NovaSea 6000 sequencer. Solexa pipe line v1.8 (Off-Line Base Caller software, v1.8) was used to process the sequencing images and obtain the sequence data. The original sequence was inspected with Pastac (vo.11.7) and filtered with Trimmomatie (vo.32). The filtered high-quality data were compared to the reference genome in the Ensenbl database (FISAT2 v210), and then exomePeak (v2.13.2) was used to determine the peaks of each sample and the differential methylation peaks of each contrast. Annotate peaks according to the annotation information in the Ensembl database and count the various transcription areas. Whether there is a peak in this paper, the motif analysis of peaks is carried out at last.

RNA stability assay

NSCs were transfected with shRNA-Alkbh3, or Overexpression-Alkbh3 and then were incubated with 5 mM actinomycin D (Sigma) for inhibition of mRNA transcription. Samples were collected at 0, 3, 6 h post treatment, and total RNA was extracted and analyzed by qRT-PCR. The experiment was performed in triplicate.

Polysome profiling

The translation efficiency of mRNA was detected by polysome profiling. In brief, the cells were incubated with 100 µg/ml of actinomycin D for 15 min before collection, followed by adding lysis buffer. Subsequently, the centrifuged lysate was added to a prepared 10–50% sucrose gradient and centrifuged at 36 000 rpm for 3 h, followed by separation with the gradient density separator. The sucrose gradient was then fractionated and UV absorption at 260 nm was recorded. The total and polysomal RNA fractions were extracted from each fraction and the relative expression of Mmp15 mRNA on the polysome fraction was detected by QRT-PCR. The experiment was performed in triplicate.

Dual-luciferase reporter assay

The Dual-luciferase assay was performed based on the Dual-luciferase reporter assay system (Promega). Cells were seeded into the 24-well plates and then were transfected with the psiCHECK-2 vector (Promega) and various constructs containing the seed sequence or mutant seed sequence of Mmp15 mRNA 3′UTR. The lysates were collected and used to measure the luciferase reporter activity. The relative luciferase activities were measured by a SYNERGY microplate reader (BioTek). The experiment was performed in triplicate.

Morris water maze

Morris water maze (MWM) experiment is a kind of experiment that forces experimental animals to swim and learn to find hidden platforms in water, mainly used to test the learning and memory ability of experimental animals to sense spatial position and sense of direction (spatial orientation). Concealed platform experiment: The pool diameter is 120 cm, the height is 50 cm, the water depth is 30 cm, and the water temperature is maintained at 26 ± 1 ℃; Four equidistant points N, E, S and W are marked on the wall of the pool as the starting point of the test. The water distribution pool is divided into four quadrants (NW, WS, SE and EN), and the platform is placed in the center of the quadrant (the distance between the platform and the center of the pool wall is equal). The platform is colorless and transparent, 10 cm in diameter and 1 cm underwater. Mice were placed in the MWM and faced the walls of the maze. The time limit for each test was 1 min. Each animal was tested a total of four times per day in each of the four quadrants, and about 5–6 days (20–24 trials) is usually enough for mice (in a 120 cm maze) to achieve stable performance. Space exploration experiments: The purpose of space exploration experiments is to determine whether the animal remembers the location of the platform. The indicators reflecting this memory include the retention time in the original platform quadrant, the number of crossing the desired platform, the average distance to the original target location, the incubation period of the first crossing the original target location, etc. The space exploration experiment should be tested at least 24 h after the end of the hidden platform experiment. All of the behavioral parameters of the mice were tracked, recorded, and analyzed using Ethovision XT 14.0 software (Noldus).

Statistical analysis

All data were analyzed using statistical software SPSS16.0 and GraphPad Prism9.1.1. The unpaired student’s t-test was used to determine the difference between the two groups. One-way ANOVA analysis and Bonferroni multiple comparison test were used to determine the difference between the multiple groups. Escape latencies during spatial learning in the Morris water maze were analyzed via two-way ANOVA. A P value of 0.05 was used as the threshold for statistical significance.