Cells and viruses

LLC-MK2 (ATCC CCL-7) cells were cultivated in minimal essential medium (MEM, Life Technologies) supplemented with 10% fetal bovine serum (FBS, Wisent, St. Bruno, QC, Canada), 1% penicillin/streptomycin (Pen/Strep, 10,000 U/mL, Gibco, ThermoFisher Scientific, Waltham, MA, USA) and 2% L-glutamin (L-Glu, Gibco, ThermoFisher Scientific, Waltham, MA, USA). HEP-2 (ATCC CCL-23) cells were cultivated in MEM medium supplemented with 5% FBS, 1% Pen/Strep, and 2% L-Glu. Vero cells (ATCC CCL-81) were cultivated in MEM medium 4,5 g/l glucose supplemented with 5% FBS, 1% Pen/Strep, and 2% L-Glu. BHK-T7 cells (a kind gift from Dr Ursula Buchholz at the NIAID in Bethesda, MD) were maintained in MEM supplemented with 10% FBS, 1% Pen/Strep, additionally supplemented with 1% non-essential amino acids (NEAA, Life Technologies) and 0.2 mg/mL geneticin (G418, Life Technologies) added every other passage.

Recombinant HMPV viruses rC-85473-GFP (rHMPV), rCAN98-75-GFP, Metavac® (ΔSH-rC-85473-GFP) and Metavac®-RSV were rescued and produced using BHK-T7 and LLC-MK2 cells, as previously described47. Recombinant RSVs expressing fluorescent proteins: GFP (rRSV-GFP), mCherry (rRSV-mCh), and Luciferase (rRSV-Luc).

Molecular biology

RNA of RSV strain A2 virus was isolated from cell culture (Qiamp MiniElute Viral RNA Spin Protocol) and reverse-transcribed with Superscript II RT reverse transcriptase (ThermoFisher Scientific, 18064014). The cDNA product was used as a matrix for amplification of RSV-F ORF using Q5 DNA polymerase (New England BioLabs, M0491L) with appropriate primers (forward: 5′- GAGTGGGACAAGTGAAAATGG-3′, reverse: 5′-GATTTGTCCCAAATTTTTATTTTTATTTTATTTTAATTTTAATTTTATTTTATTTTAATTTAATTTACTTTATTTTTAATTAATTAGTT-3′). RSV-F gene was flanked by HMPV-derived Gene Start and Gene End signals (Fig. 1A), and HMPV genome overlapping regions were added at the 5′ and 3′ extremities of the RSV-F amplicon.

The pSP72 plasmid containing the complete genome of Metavac® (pSP72-ΔSH-rC-85473-GFP/ pSP72-Metavac®) virus44,45 was amplified with Q5 DNA polymerase using primers matching the intergenic F-M2 region (forward: 5′- AACTAATTAATTAAAAATAAAGTAAATTAAATTAAAATAAAATAAAATTAAAATTAAAATAAAATAAAAATAAAAATTTGGGACAAATC-3′, and reverse 5′-CCATTTTCACTTGTCCCACTC-3′).

The RSV-F amplicon was then inserted into the linearized pSP72-Metavac® vector by Gibson Assembly® Cloning Kit (New England Biolabs, E5510S) in a 2-fragment cloning reaction, following the provider’s recommendations. Briefly, 75 ng of a linearized vector with a 3-fold molar excess of the insert was used. The reaction product was then diluted 4 times in distilled water, and 2 µl were transformed into Stellar™ Competent Cells (Takara Bio). Bacteria were plated in a selective medium containing Ampicillin and plasmids were isolated by Gene Elute Plasmid Purification Kit (Sigma-Aldrich). The complete plasmid DNA sequence was confirmed by Sanger sequencing.

Reverse genetics

BHK-T7 cells at 75% confluency were co-transfected with four supporting plasmids encoding ORFs of N, P, L, and M2-1 of HMPV strain B2/CAN98-75, as well as with pSP72 plasmid containing the full-length antigenome of Metavac®-RSV virus using Lipofectamine 2000 (ThermoFisher Scientific, Life Technologies), according to a previously described protocol47. Transfected cells were incubated at 37 °C and 5% CO2 for 2 days until the GFP expression was noticeable. Next, LLC-MK2 cells were added for co-culture in OptiMEM infection medium supplemented with fresh 0.0002% trypsin, as previously described47. Cells were scraped, sonicated, and centrifuged, and the supernatant was diluted to inoculate newly seeded LLC-MK2 monolayers. After several cell passages, recombinant Metavac®-RSV virus was concentrated by ultracentrifugation at 28,000 rpm, resuspended in OptiMEM, and stored at −80 °C. Viral stocks were titrated as 50% tissue culture infectious doses (TCID50)/ml.

Immunostaining

For various immunostaining assays, we used the humanized anti-RSV-F monoclonal antibody (mAb) Palivizumab (Synagis®, AstraZeneca™), anti-HMPV-F mAb (HMPV24, Abcam ab94800), anti-HMPV-N mAb (HMPV123, Abcam ab94803), in-house polyclonal HMPV- or RSV-specific murine sera, respectively generated by mouse infection with HMPV C-85473 or RSV A2 viruses.

For flow cytometry assays, HMPV24 mAb was conjugated with fluorochrome Alexa Fluor™ 647 (Alexa Fluor 647 Antibody Labeling Kit, Invitrogen, A20186), and Palivizumab was conjugated with fluorochrome R-Phycoerythrin (PE/R-Phycoerythrin Conjugation Kit - Lightning-Link®, Abcam, ab102918).

Transmission electron microscopy

Metavac® and Metavac®-RSV viruses were produced in LLC-MK2 cells and concentrated by ultracentrifugation, as previously described44. Viral pellets were then resuspended in 0.9% NaCl and passed through a 0.45 µm filter. Viral suspensions were adsorbed on 200-mesh nickel grids coated with formvar-C for 10 min at room temperature (RT). Immunogold labeling was performed the next day by flotation of the grids on drops of reactive media. Nonspecific sites were coated with 1% BSA in 50 mM Tris-HCl (pH 7.4) for 10 min at RT, then incubated in a wet chamber with Palivizumab diluted in 1% BSA, 50 mM Tris-HCl (pH 7.4) for 2 h at RT. The grids were washed successively in 50 mM Tris-HCl (pH 7.4 and then pH 8.2), incubated with 1% BSA, 50 mM Tris-HCl (pH 8.2) for 10 min at RT, and labeled with 15 nm gold conjugated goat anti-human IgG (Aurion) diluted 1/50 in 1% BSA, 50 Mm Tris-HCl (pH 8.2) for 45 min. A second immunogold labeling with in-house anti-HMPV murine serum was then performed following the same protocol. Finally, the immunocomplex was fixed with 2% glutaraldehyde diluted in 50 mM Tris-HCl (pH 7.4) for 2 min, and grids were stained with UranyLess (Electron Microscopy Sciences, 22409) for 1 min and observed on a TEM (Jeol 1400 JEM, Tokyo, Japan) equipped with a Gatan camera (Orius 1000) and Digital Micrograph Software.

Replication kinetics

Confluent monolayers of LLC-MK2 cells were washed with PBS and infected with a MOI of 0.01 of Metavac®-RSV or Metavac® vaccine candidates diluted in OptiMEM. Cells were incubated for 1.5 h at 37 °C, then infectious media was aspirated and replaced by fresh OptiMEM with 0.0002% trypsin. Infected cells were incubated at 37 °C and 5% CO2 and supernatants were harvested in triplicate at daily intervals for 7 days and then frozen at −80 °C. Each sample was thawed and used for the determination of TCID50/ml in LLC-MK2 cells.

Confocal microscopy

For confocal microscopy observations, confluent monolayers of LLC-MK2 cells grown on Lab-Tek II chamber slides (ThermoFisher Scientific) were infected with a MOI of 0.01 of recombinant Metavac®, Metavac®-RSV or rRSV-GFP viruses. After 3 days of infection, infected cells were fixed with 4% paraformaldehyde in PBS for 30 min at 4 °C, washed in PBS 1X, permeabilized with 0.1% Triton X-100 in PBS (PBS-T), and blocked with 1% SVF for 30 min. Then, anti-RSV-F Palivizumab and anti-HMPV-F HMPV24 antibodies were used as primary antibodies in PBS-T at 1/5000 and 1/500 dilutions, respectively. After 1 h-incubation, the cells were washed in PBS-T and then incubated with goat anti-human mAb conjugated with AlexaFluor 546 and goat anti-mouse mAb conjugated with AlexaFluor 633 (ThermoFisher Scientific) for 30 min at 1/100 dilution. Nuclei were counterstained with DNA-binding fluorochrome 4,6-diamidinon-2-phenylindole (DAPI, Invitrogen). After staining, the coverslips were mounted with Fluoromount G (Cliniscience) and analyzed using a confocal inverted microscope (Zeiss Confocal LSM 880).

Flow cytometry

For flow cytometry assays, confluent monolayers of LLC-MK2 cells grown in 24-well plates were infected with an MOI of 0.5 of Metavac®-RSV or Metavac® vaccine candidates. After 1.5 h of virus adsorption, the infection medium was replaced by fresh OptiMEM with 0.0002% trypsin. At 48 h post-infection, cells were washed with cold PBS, trypsinized, and resuspended in cold PBS supplemented with 2% FBS. A wash with cold PBS 2% FBS was performed between each step involving antibodies. First, cells were incubated with an optimized concentration of viability dye (LIVE/DEAD™ Fixable Near-IR Dead Cell Stain Kit, ThermoFisher Scientific, L34975) for 30 min at 4 °C. After subsequent washes, samples were incubated for 30 min at 4 °C with optimized concentration of HMPV24 mAb conjugated with Alexa Fluor 647 and Palivizumab conjugated with R-Phycoerythrin. Cells were sorted and analyzed by LSR II Flow Cytometer (BD biosciences®) cytometer to determine: the percentage of infected GFP-positive cells, the percentage of GFP-positive cells with simultaneous HMPV-F and RSV-F expression revealed by HMPV24 antibody, and Palivizumab, respectively. Compensation control for the viability dye was performed with live and dead LLC-MK2 cells. Compensation controls for conjugated antibodies were performed using compensation beads (UltraComp eBeads™ Compensation Beads, ThermoFisher Scientific, 01-2222-42). Approximately 30,000 single live cells were counted per sample, and the experiment was performed in triplicate.

Infection of reconstituted HAE

In vitro reconstituted HAE, derived from healthy donors’ primary nasal cells (MucilAir™), was purchased from Epithelix (Plan-les-Ouates, Switzerland). HAEs were incubated with a MOI of 0.1 of Metavac® or Metavac®-RSV for 2 h at 37 °C, 5% CO2. Infections were monitored for 7 days post-infection (dpi). At 3, 5, and 7 dpi, apical washes with warm OptiMEM were performed in order to extract viral RNA (QIAamp Viral RNA kit, Qiagen, Hilden, Germany), and the images of infected HAEs were taken by fluorescent microscopy with EVOS M5000 Cell Imaging System (Invitrogen, ThermoFisher Scientific).

For fluorescence immunostaining, infected HAEs with a MOI of 0.1 of Metavac®, Metavac®-RSV or rRSV-GFP were rinsed three times with 1X Dulbecco’s PBS (DPBS, Gibco, 14190) at 3 dpi and fixed for 50 min in 4% paraformaldehyde solution (Electron microscopy science, 15710) at RT. HAEs were rinsed three more times in DPBS, then the tissue was embedded in paraffin, and sections of 5 µm-thick slices were prepared using a microtome. Immunostaining was then performed with Discovery XT (Roche) device. Fixed tissues were first deparaffinized and incubated with RiboCC citrate buffer (pH 6.0) for 16 min. The slices were subsequently stained with primary antibodies Palivizumab and HMPV123 mAb at 1:1000 or 1:100 dilutions, respectively, for 1 h at 37 °C, and then with secondary antibodies (Alexa 488 GAR Invitrogen, A11 008 or Alexa 594 GAH Invitrogen™, A11 014) at 1:500 or 1:300 dilution, respectively, for 1 h at 37 °C. The nuclear staining was performed with DAPI. The images were acquired with an inverted confocal microscope (Zeiss Confocal, LSM 880).

Real-time RT-PCR

The RNA was reverse-transcribed at 42 °C using SuperScript™ II RT (Invitrogen) with random primers. Amplification of the HMPV-N gene was performed by RT-qPCR using Express one-step SYBR GreenER mix, premixed with ROX (ThermoFisher Scientific) and with forward primer 5′-AGAGTCTCAGTACACAATAAAAAGAGATGTGGG-3′ and reverse primer 5′-CCTATTTCTGCAGCATATTTGTAATCAG-3, and amplification of the RSV-F gene was performed using forward primer 5′-CTGTGATAGARTTCCAACAAAAGAACA-3′ and reverse primer 5′-AGTTACACCTGCATTAACACTAAATCC-3′. The calibration of HMPV-N and RSV-F copies was assessed by amplification of a plasmid.

Animal studies

For in vivo infection studies, 4–6-week-old BALB/c mice (Charles River Laboratories), randomly housed in groups of 5–6 per micro-isolator cage, were infected via IN route with 5 × 105 TCID50 of rHMPV, Metavac® or Metavac®-RSV, based on previous study44, under ketamine/xylazine anesthesia. As a control group, mice were mock-infected IN with OptiMEM medium. Animals were monitored daily for 14 days for weight loss, clinical disease signs, reduced activity, or ruffled fur, and were euthanized upon 20% loss of the initial weight. Mice were euthanized using sodium pentobarbital at 2 dpi (n = 2/group) to perform BALs for viral genes quantification by RT-qPCR, or at 5 dpi (n = 3/group) to harvest their lungs for histopathological analysis. For histopathological analysis, whole lungs were perfused with 2% formaldehyde at the time of the harvest, embedded in paraffin, and tissue sections were stained with hematoxylin-eosin. Each of the following compartments (interstitium, alveoli/intra-alveolar, peribronchial, perivascular, intrabronchial, and pleural) was scored from 0 (normal) to 4 (severe) based on inflammation criteria (NovaXia Pathology Laboratory). Retrospectively, the quantification of viral gene expression by RT-qPCR was also performed from fixed lung slices after total RNA extraction using RNeasy® DSP FFPE Kit (Qiagen), following manufacturer instructions.

For the vaccination studies, 4–6 week-old BALB/c mice were immunized twice with a 21-day interval before receiving a viral challenge 21 days after the last immunization. Animals were monitored daily for 14 days after each immunization or infection for weight loss, clinical signs, reduced activity, or ruffled fur and were euthanized upon 20% loss of their initial weight.

To assess the protection against the HMPV challenge, sixteen animals were immunized by the IN route with 5 × 105 TCID50 of Metavac® or Metavac®-RSV, or by IM route with HMPV split preparation consisting of inactivated HMPV C-85473 virus, as previously described73, diluted 1:1 with squalene-based oil-in-water nano-emulsion AddaVax™ (Invivogen). Mice mock-infected IN with OptiMEM (mock vacc.) were used as a negative control vaccination group. Twenty-one days after the second immunization, each mouse was infected with 2 × 106 TCID50 of rHMPV, expected to induce lethality in >80% of the animals. At 2 days post-challenge (dpc), mice were euthanized (n = 2/group) to collect NW and BALs in PBS 1× to measure HMPV-N gene copies by RT-qPCR. Viral titers (n = 4/group) and histopathological scores (n = 3/group) were evaluated at 5 dpc from lung homogenates or from formaldehyde-fixed tissues, respectively, as previously described44. Prior to immunizations (day −1 or day 20), prior to challenge (day 41), and 21 days after challenge (day 63), blood samples were taken by sub-mandibular bleeding or cardiac puncture at the terminal time-point to evaluate neutralizing antibodies (NAbs) and IgG titers.

To evaluate the protection against the RSV challenge, twelve animals were immunized by the IN route with 5 × 105 TCID50 of Metavac®-RSV or with 5 × 105 PFU of rRSV-mCh viruses. As a negative control group of vaccination, mice were mock-infected IN with OptiMEM (mock vacc.). Twenty-one days after the second immunization, each mouse was infected with an inoculum of 3.75 × 105 PFU of rRSV-Luc virus, as previously described74. To determine in vivo bioluminescence intensity, mice (n = 8/group) were anesthetized 3 and 5 dpc and observed alive using the IVIS imaging system 5 min after IN injection of D-luciferin. At 4 dpc, mice were euthanized (n = 4/group), lungs homogenized in 1 ml of PBS 1× before total RNA extraction, and the quantification of RSV-F and HMPV-N genes by RT-qPCR was performed as previously described. Prior to immunizations (days −1 or day 20), prior to challenge (day 41), and 21 days after challenge (day 63), blood samples were taken by sub-mandibular bleeding or cardiac exsanguination at the terminal time-point to evaluate neutralizing antibody (NAb) and IgG titers.

Neutralization assays

To evaluate the production of a specific neutralizing antibody response, sera were recovered from blood samples, pooled, and heat-inactivated at 56 °C until testing. Serial two-fold dilutions of sera in the infection medium were then tested for neutralization of homologous rHMPV (rC-85473-GFP), heterologous HMPV (rCAN98-75-GFP) or rRSV-mCh viruses on LLC-MK2 cells or Vero cells, respectively. Reciprocal neutralizing antibody titers were determined by an endpoint dilution assay, based on fluorescent detection (Spark® multimode microplate reader, TECAN). Neutralization of infection was defined as >75% decrease in the fluorescence, compared to the negative infection control.

IgG quantification by ELISA assays

To detect HMPV-, RSV- or preF RSV-specific IgG in mice sera, NUNC Maxi-Sorp 96-well plates (ThermoFisher Scientific) were coated with inactivated virus stocks (HMPV C-85473 or RSV A2 strains, respectively) at 4 µg/ml or recombinant preF RSV protein at 2 µg/ml diluted in carbonate-bicarbonate buffer (0.1 M, pH 9,6).

The PreF RSV protein was obtained by transfection of a pcDNA 3.1+ plasmid encoding DS-Cav1 preF A2 ORF into Expi293F cells using ExpiFectamine 293 reagent (Expi293™ Expression System Kit, ThermoFisher Scientific), as previously described75.

Plates were subsequently blocked with 5% milk in PBS-T and incubated with serum samples diluted in 5% milk in PBS-T. Specific IgG antibodies were detected using an anti-mouse IgG-HRP mAb (SouthernBiotech, ref 1031-05). ELISAs were developed using tetramethylbenzidine (TMB SureBlue, SeraCare), and the reaction was stopped with 2 N H2SO4. Background from empty control wells was subtracted to acquire final absorbance values at 450 nm, and the results were represented as arbitrary units to compare IgG titers at an optimal serum dilution.

Ethics and biosecurity

HMPV animal studies were approved by the SFR Biosciences Ethics Committee (CECCAPP C015 Rhône-Alpes, protocol ENS_2017_019) according to European ethical guidelines 2010/63/UE on animal experimentation. The protocol of RSV challenge was approved by the Animal Care and Use Committee at “Centre de Recherche de Jouy-en-Josas” (COMETHEA) under relevant institutional authorization (“Ministère de l’éducation nationale, de l’enseignement supérieur et de la recherche”), under authorization number 2015060414241349_v1 (APAFiS#600). All experimental procedures were performed in a Biosafety level 2 facility.

Statistical analysis

Statistical analyses were performed with GraphPad Prism10 using one-way or two-way ANOVA tests.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.