Animals and experimental design

Age-matched C57BLKS/J db/db (week 10, male, N = 40) and db/m mice (week 10, male, N = 16) were purchased from Beijing Huafukang Biotechnology Co., Ltd. The Committee Ethics approved all animal experiments at Dongguan Tungwah Hospital. All mice were housed in the University animal facility with a 12 h light/dark cycle and free to access water and pellet chow. Diabetic mice were randomly divided into four groups (n = 8 for each group): db/db, db/db + wogonin, db/db + wogonin + sh-SOCS3, db/db + wogonin + sh-SOCS3 + sh-TLR4. Db/m mice were used as the normal control. Mice in diabetic groups were administered 40 mg/kg wogonin (W0769, Sigma-Aldrich, MA, USA) every other day for 12 weeks (Liu et al. 2022; Zheng et al. 2020). Control mice (db/db) were given the same volume of dimethyl sulfoxide (DMSO, 0.1 mL). To inhibit SOCS3 and TLR4 genes, we injected the diabetic mice intravenously with 50 µL of lentivirus carrying SOCS3, TLR4, or negative control with a 1 × 1011 virus particles/mL titer. The mice in the db/db + wogonin group were injected with the same volume of saline as a control. Mice were sacrificed at week 22. Subsequently, we collected the kidney, blood, and urine for subsequent analysis.

Blood glucose and insulin level

To confirm the successful establishment of diabetic mice, we performed intraperitoneal glucose tolerance test (IPGTT) and intraperitoneal insulin tolerance test (IPITT) after 12-week feedings. After fasting for 6 h, glucose (2.0 g/kg body weight) or insulin (0.75 U/kg body weight) was intraperitoneally administered. After the injection (0, 15, 30, 60, and 120 min), the blood from the tail vein was collected to measure the glucose and insulin levels using a Freestyle blood glucose monitoring system in NJ, USA.

To measure blood glucose, we collected the blood from the tail vein of mice after overnight fasting at the indicated time points (days 6–22). Glucose levels were detected using a glucose colorimetric kit (EIAGLUC, Thermo Fisher Scientific, MA, USA).

Biochemical assays

To measure blood urea nitrogen (BUN), serum creatinine values (Scr), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP), mice performed cardiac punctures to collect the blood (200–300 µL). The corresponding commercial kits measured the BUN, Scr, ALT, AST, ALP (EIABUN, Thermo Fisher Scientific, MA, USA, and SKT-217-192, Eagle Biosciences, NH, USA) with detailed instructions. For the urine albumin, we measured 24-hour urinary albumin excretion levels using a mouse albumin ELISA kit (E99-134, Fortis Life Sciences, MA, USA).

Hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) staining

After the mice were sacrificed, the kidneys were harvested and fixed with 4% paraformaldehyde (PFA). The sections were conducted into 10 μm thickness. Subsequently, hematoxylin and eosin were used to analyze the pathological structure changes (H&E, H-3502-NB, Novus Biologicals, LLC, CO, USA). The glycogen levels in tissues were evaluated using a periodic acid-Schiff (PAS) stain kit (AR165, Agilent, CA, USA). The distributions of glycosylated proteins were observed under a light microscope (DP-71; Olympus, Tokyo, Japan).

Cell culture and high glucose administration

Human renal proximal tubule HK-2 cells (CRL-2190™, ATCC, VA, USA) were maintained in keratinocyte serum-free medium (K-SFM, 17005-042, ATCC, VA, USA) in a cell culture incubator. HK-2 cells were subject to 30 mmol/L of glucose for 24 h as high glucose exposure(Cui et al. 2023; Li et al. 2021; Liu et al. 2023). To investigate the roles of wogonin in HG-induced cell toxicity, we exposed HK-2 cells to increasing concentrations of wogonin (1, 2, 4, 8, 16, 32, and 64 µM) for 24 h to determine the suitable concentration for acute toxicity. We chose 8 µM as an optimal concentration for the co-treatment with wogonin and HG based on the cell viability. The treatment with mannitol (8 µM) for 24 h was used as the negative control. Mannitol plus HG medium was used as a control. In brief, cells were divided into three groups: (1) negative control, (2) HG, and (3) HG + wogonin. For in vitro cell viability, the assays were conducted using a commercial CCK-8 kit (96,992, Sigma-Aldrich, Beijing, China).

Cell transfection

We conducted loss- and gain-of-function assays using lentivirus infection to evaluate the role of SOCS3 and TLR4 in vitro and in vivo. We purchased lentivirus expressing shRNA- or ov-SOCS3 or TLR4. After 24 h, the spent medium was changed into the complete HK-2 medium containing HG (30 mM) or HG (30 mM) + wogonin (8 µM). After a further 48 h, the cells were collected for future assays.

RT-qPCR

After stimulation, total RNAs were extracted using an RNeasy mini kit (Qiagen, CA, USA). 1.0 µg of total RNA was reversely transcribed into cDNA using a commercial kit (4,387,406, Thermo Fisher Scientific, MA, USA). RT-qPCR was conducted using SYBR™ Green One-Step RT-qPCR Kit (11,736,059, Thermo Fisher Scientific, MA, USA ). The used primers are listed below: human SOCS3 F, 5- CCTGCGCCTCAAGACCTTC-3; R, 5- GTCACTGCGCTCCAGTAGAA-3; human TLR4 F, 5- CCTCGGCGGCAACTTCATAA-3; R, 5- AGAGCGGATCTGGTTGTACTG-3; human β -actin F, 5- CCCTGGAGAAGAGCTACGAG − 3; β-actin R, 5- CGTACAGGTCTTTGCGGATG − 3. Mouse SOCS3 F, 5- GCGGGCACCTTTCTTATCC-3; R, 5- CTGGAGGCGGCATGTAGTG-3; mouse TLR4 F, 5- ACCTGGCTGGTTTACACGTC − 3; R, 5- CTGCCAGAGACATTGCAGAA − 3; mouse β-actin F, 5- ATATCGCTGCGCTGGTCG − 3; β-actin R, 5-CCTTCTGACCCATTCCCACC-3. The corresponding sample evaluated the relative quantifications of SOCS3 and TLR4 by the 2−△△ Ct method. β-actin was used as an internal control.

Measurement of ROS, MDA, GSH, and SOD content

Cells were stained by fluorescent dye 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA, D399, Thermo Fisher Scientific, MA, USA) to detect intracellular reactive oxygen species (ROS). A Nikon A1R laser scanning confocal microscope (Nikon Corp., Tokyo, Japan) was used to image cells after staining.

After treatment with vehicle, HG, or HG + wogonin, the corresponding commercial kit was used to detect the levels of malondialdehyde (MDA, NWK-MDA01), glutathione (GSH, NWK-GSH01), superoxide dismutase (SOD, NWK-SOD02) in HK-2 cells of each group according to the detailed instructions (Northwest Life Science Specialties, LLC, WA, USA).

ELISA assay

To assess the cytokine secretion after stimulations, we purchased the respective commercial ELISA kit for TNF-α, IL-1β, IL-6, IL-8, circulating adiponectin, and leptin from Biolegend, CA, USA. Albuminuria and urinary albumin-to-creatinine ratio (ACR) were detected using Mouse Albumin ELISA Quantification Set (E99-134, Fortis Life Sciences, MA, USA) and Creatinine Companion kit (EIACUN, Thermo Fisher Scientific, MA, USA), respectively. The absorbance was detected at 450 nm using a 96-microplate reader (GM3000, Promega, WI, USA). The quantification of cytokines was calculated using a standard curve.

Western blot

After collection, HK-2 cells and renal tissues were lysed using RIPA buffer (89,900, Thermo Fisher Scientific, MA, USA) containing 0.1 M phenylmethylsulphonyl fluoride (PMSF, 36,978, Thermo Fisher Scientific, MA, USA). The supernatant was collected after pre-clear by centrifugation (12,000 g × 15 min) at 4℃. Protein concentration was determined using a BCA protein assay kit (23,227, Thermo Fisher Scientific, MA, USA). 20 µg of total proteins for each sample were subjected to 12% SDS-PAGE and transferred to Nylon membranes (LC2003, Thermo Fisher Scientific, MA, USA). After blocking with 5% non-fat milk in 1 × Tris-buffered saline with 0.1% Tween® 20 Detergent (TBST), the membranes were incubated with the corresponding primary antibodies (shown in Table 1). After three washes by 1×TBST, the membranes were incubated with the corresponding horseradish peroxidase-labeled secondary antibody (shown in Table 1). The membrane was developed using an ECL substrate kit (ab65623, Abcam, MA, USA). The protein bands were analyzed by Image Lab Software 6.1 (Bio-Rad, CA, USA).

Table 1 List of antibodies used in this studyImmunoprecipitation (IP assay)

HK-2 cells were transfected with pCMV empty vector or pCMV SOCS-3 for 48 h. Then, cells were lysed using IP Lysis/Wash Buffer supplemented with Halt™ Protease (Product No. 78,430) and Phosphatase (Product No. 78,428) Inhibitor Cocktails. Subsequently, Co-Immunoprecipitation was performed using a commercial Pierce™ Co-Immunoprecipitation Kit (PI26149, Thermo Scientific™, MA, USA) according to the detailed manual. The rabbit anti-SOCS3 (ab280884, Abcam, MA, USA) and rabbit anti-TLR4 (19811-1-AP, Proteintech, CA, USA) were used individually to detect the expressions of SOCS3 and TLR4.

Statistical analysis

All data were represented as Mean ± standard deviation (SD). All experiments were conducted three times. The statistical difference was analyzed using an unpaired two-tailed t-test or one-way ANOVA of variance with the post hoc Tukey test by GraphPad Prism 9.0 (CA, USA). P < 0.05 was considered statistical significance.