Tissue samples

The clinical study received approval from the Ethics Committee of Zhuzhou Hospital, affiliated with Xiangya Medical College of Central South University. Written informed consent was obtained from all participating individuals. Meningioma tissue samples and non-cancerous tissues (n = 35) were collected from patients meeting the following selection criteria: (i) a diagnosis of meningioma with no history of other tumors, and (ii) the availability of complete clinical information, including age, gender, and tumor volume. The collection and utilization of these tissue samples adhered to the National Regulations on the Use of Clinical Samples in China.

Cell culture and transfection

Normal meningothelial cells (MECs) and meningioma cell lines IOMM-Lee and CH157-MN were obtained from the American Type Culture Collection (Manassas, VA, USA). The CD8+ T cells that isolated form adult male peripheral blood was purchased from Bluefcell (#BFN60810741, Shanghai, China). All these cell types were cultured in Dulbecco’s Modified Eagle’s Medium (Thermo Fisher Scientific, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Sigma, St. Louis, MO, USA) in a 5% CO2 humidified atmosphere at 37 °C. For stimulation of CD8+ T cells, the cells were incubated with Dynabeads® that coated with anti-CD3 and anti-CD28 (#11161D, Thermo Fisher Scientific, Carlsbad, CA, USA) for two days, thus the activated CD8+ T cells were co-cultured with meningioma cells by a transwell chamber.

For the construction of knockdown or overexpression cellular models, pcDNA3.1-circ_0004872, pcDNA3.1-PD-L1, sh-EIF4A3, as well as their respective negative controls (pcDNA3.1 and shNC), were sourced from GenScript (Shanghai, China). Cell transfections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s instructions.

Cell viability

Cell viability was assessed using a CCK8 assay kit (Solarbio, Beijing, China) according to the manufacturer’s protocols. Briefly, cells were seeded in 96-well plates at a density of 5 × 103 cells per well and incubated under various conditions for 24, 48, and 72 h. Subsequently, CCK8 solution (10 µL) was added to each well and maintained for 2 h at 37 °C in the dark. A microplate reader (Molecular Devices, Sunnyvale, CA, USA) was used to measure absorbance at 450 nm.

Cell migration and invasion assays

To assess the metastasis of meningioma cells, chambers (8.0 μm, Corning, NY, USA) covered with/without Matrigel (BD Biosciences, Bedford, MA, USA) were used. Cells were harvested after the indicated treatment and then incubated in serum-free medium for 6 h. Subsequently, cells were collected and resuspended in serum-free medium. Afterwards, 200 µL of cell suspension (5 × 104 cells) was plated in the upper chambers, with 600 µL of complete medium in the bottom chamber. After 48 h of culture, migratory and invasive cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. The cells were counted using a light microscope (Olympus, Tokyo, Japan). Notably, invasion experiments involved the use of Matrigel in the upper chamber.

LDH assay

Cytotoxicity was determined using the Cytotoxicity Detection Kit (LDH) (Beyotime, Shanghai, China) according to the manufacturer’s instructions. IOMM-Lee and CH157-MN cells subjected to different treatments were co-cultured with CD8+ T cells at varying ratios of 2:1, 3:1, and 5:1 for 48 h. A six-well transwell system (0.4 mm pore size membrane; Corning, Oneonta, NY, YSA) was used to assess the interactions between CD8+ cell and meningiomas cells. After co-culture, CD8 + T cells were harvested for apoptosis detection, and meningiomas cells were obtained for LDH release assay. Cytotoxicity of CD8+ T cells against meningioma cells was quantified through the LDH assay. The difference in absorbance (OD490-OD680) represented LDH activity, and the percentage cytotoxicity was calculated using the formula: % cytotoxicity = [1-(OD case-OD effector cell)/OD target cell] × 100%.

Cell apoptosis

IOMM-Lee and CH157-MN cells with different treatment were co-cultured with CD8+ T cells at dissimilar ratios of 2:1, 3:1 and 5:1 for 48 h. Then, the harvested co-cultured CD8 + T cells as described in LDH assay was used for apoptosis measurement. Briefly, the transfected cells were trypsinized, rinsed with cold PBS buffer, and then resuspended at a density of 5 × 105 cells/mL. Then, cells were stained with 5 µL of Annexin V-FITC/PI staining solution (BD Biosciences, San Jose, CA, USA) for 15 min. After washing with 1× binding buffer, the cells were treated with 10 µL of PI (Solarbio, Beijing, China) as recommended by the manufacturer. The apoptosis rate was quantified using a flow cytometer (BD Biosciences, San Jose, CA, USA).

RT-qPCR

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Following the protocols of the reverse transcription reagent kit (TaKaRa, Tokyo, Japan), cDNA was synthesized. Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green qPCR Mix (TaKaRa) on the ABI quantitative PCR system (Waltham, MA, USA). β-actin served as an endogenous control, and relative RNA expression was calculated using the 2−ΔΔCt method. The gene primers used were as follows:

hsa_circ_0004872-F:5’-CCCGTGTTGCAGATCCAGAC -3’;

hsa_circ_0004872-R:5’- GGGTTCTCTGGCAGTAGGTC-3’;

PD-L1-F: 5’- ACCACCACCAATTCCAAGAG-3’;

PD-L1-R: 5’- GATGGCTCCCAGAATTACCA -3’;

EIF4A3-F: 5’- GACTCTGGAAGGCATCAAGC-3’;

EIF4A3-R: 5’- AGTGAAGTTGGCTTCCCTCA-3’;

β-actin-F: 5’- CCCTGGAGAAGAGCTACGAG -3’;

β-actin-R: 5’- CGTACAGGTCTTTGCGGATG-3’.

Western blot analysis

Total proteins were extracted using RIPA lysis buffer (Bocai, Shanghai, China). After centrifugation, the supernatant was collected, and protein concentrations were determined using a BCA Assay Kit (Beyotime, Shanghai, China). Proteins were separated by 10% SDS-PAGE gel. Following electrophoresis, proteins were transferred to PVDF membranes (Millipore, MA, USA) and blocked with 5% non-fat milk. Membranes were then incubated with primary antibodies, including anti-PD-L1 (ab205921, abcam, Cambridge, MA, USA), anti-EIF4A3 (ab180573, abcam), and anti-GAPDH (ab8245, abcam) at 4℃ for overnight. On the following day, the membranes were probed with an HRP-conjugated rabbit anti-mouse IgG secondary antibody (ab6728, abcam) for 2 h at room temperature. An ECL kit (Invitrogen) was used to develop the protein bands, and the band density was quantified using ImageJ software.

RIP assay

The RNA-protein immunoprecipitation (RIP) assay was conducted using the EZ-Magna RIP Kit (Millipore, Bellerica, MA). Cell lysates were extracted and incubated with anti-EIF4A3 (ab180573, abcam) or anti-IgG antibody (ab172730, abcam) that coated with protein A sepharose beads at 4 °C overnight. Samples were subsequently treated with proteinase K, and the extracted RNAs were analyzed using RT-qPCR.

RNA pull down

Magnetic RNA-protein Pulldown Kit (Thermo Scientific, Waltham, MA, USA) was obtained for RNA pull-down analysis. Briefly, the biotin-labeled probes (biotin-sense, biotin-antisense) that targeted the junction site of hsa_circ_0004872 were synthesized by GenePharma (Shanghai, China). The antisense sequence of hsa_circ_0004872 was used as a non-specific control. To obtain cell lysates, cells were treated with lysis buffer containing protease and RNase inhibitors and incubated on ice for 30 min. Subsequently, the biotin-labeled probes were incubated with streptavidin magnetic beads at 4 °C overnight. The obtained lysates were incubated with prepared magnetic beads for overnight. Then, the beads were collected and the proteins pulled down by probes-beads complexes were harvested using a protein elution buffer. Finally, the probe interacted proteins were determined using western blot.

RNA stability

In brief, a total of 2 mg/ml actinomycin D was used for cell treatment. Total RNA was extracted at various time points (0, 3, 6, 9, and 12 h), and the relative RNA levels were determined by RT-qPCR to evaluate RNA stability.

Statistical analysis

Quantitative data were presented as the mean ± standard deviation (SD). All statistical analyses were conducted using GraphPad Prism 7.0. A Student’s t-test was employed for comparisons between two groups, while one-way analysis of variance followed by Tukey’s post hoc test was used for comparisons involving three or more groups. P < 0.05 was considered statistically significant. All experiments were performed in triplicate.