Chemicals and antibodies used in this study

The culture medium of DMEM/F12 was purchased from Hyclone (Logan, UT). Fetal bovine serum (FBS) was obtained from Sijiqing (Zhejiang, China). The 0.25% trypsin-EDTA was purchased from Thermo Fisher Scientific (Waltham, MA, USA). The cisplatin was purchased from Sigma–Aldrich, St. Louis, MO and dissolved in 0.9% saline to a concentration of 1 mg/ml, stored at 4 °C in the dark. The FTO plasmid was designed and synthesized by Miaoling (Wuhan, China). siRNA aimed at FTO was synthesized by RiboBio (Guangzhou, China). Lipofectamine 2000 (Thermo Fisher Scientific, Waltham) was used for the following transfection according to the manufacturer’s instructions. The inhibitor of YAP1-verteporfin (VP) was purchased from MedChemExpress (Shanghai, China).

The primary antibodies include: FTO (1:1000, ab126205, Abcam, USA), MST1 (1:1000, 22245-1-AP, Proteintech, China), phosphor - MST1 (Thr183)/MST2 (Thr180) (E7U1D) (1:1000, 49,332, CST, USA), LATS1 (1:1000,17049-1-AP, Proteintech, China), phosphor - LATS1 (Ser909) (1:1000, 9157, CST, USA), YAP1 (D8H1X) (1:1000, 14,074, CST, USA), phospho -YAP (Ser127) (D9W2I) (1:1000, 13,008, CST, USA), BAX (1:1000, 50599-2-Ig, Proteintech, China), Bcl-2 (1:1000, 12789-1-AP, Proteintech, China), PCNA (1:1000, 10,205–2 – AP, Proteintech, China), β-actin (1:1000, 66099-1-Ig, Proteintech, China), cleaved-caspase 3 (1:1000, 9661S, CST, USA).

The KGN cells culture and treatment

The KGN cell line (a human ovarian granulosa cell line) was purchased from Procell Life Science&Technology Co., Ltd (Wuhan, China). The cells were cultured in DMEM/F12 with 10% FBS at 37℃ in 5%CO2, and which were sub-cultured every other day. 2 × 105 KGN cells were seeded per well in a six-well plate one day in advance. The following day, the culture medium was replaced, and 2 ml of complete medium was added to each well. Subsequently, 0, 0.6, 3, and 6 µl of cisplatin (1 mg/ml) were added to individual wells to achieve final concentrations of 0, 1, 5, and 10 µM respectively.

FTO protein overexpression and knockdown

Overexpression of FTO was achieved by transfection the pCAG-FTO (human)-3×FLAG, and an empty vector (P19606/pCAG-MCS-3×FLAG) was used as a negative control (NC). FTO protein knockdown was performed with human FTO-specific small interfering RNAs (siRNAs) (Ribobio, Guangzhou, China). Among the 3 siRNAs, at least 2 of them with different sequences were verified to significantly knock down the expression level of FTO. Lipofectamine 2000 regent was used for the cells transient transfection. For the plasmid transfection, 3.0 µg vector DNA and 3 µL Lipofectamine 2000 were added to each well of the 6-well plate, when the cell confluence reached to 60–80%. And for the siRNA transfection, 50 nM siRNAs were transfected with 3 µL Lipofectamine 2000 per well for the 6-well plate. According to the manufacturer’s instruction, after transfected for 6 h, the serum free medium was replaced with complete culture medium. Finally, the transfection efficiency was confirmed by qRT-PCR and western blotting.

Flow cytometry assay for cell apoptosis

KGN cells transfected with plasmid or siRNAs were harvested and stained with Annexin V-PE / 7-AAD according to the manufacturer’s instruction (BD Biosciences, CA, USA). In brief, after transfection, the KGN cells were cultured in the 6-well plate for another 48 h, and then harvested and centrifuged at 1000 rpm / min for 5 min. Washing the cells with ice – cold PBS for twice and resuspending them in 100 µL 1 × binding buffer (diluted with distilled water). Next, 5 µL PE-Annexin V and 5 µL 7-aminoactinomycin D (7-AAD) were added and incubated for another 15 min (at room temperature, in the dark). Finally, another 400 µL 1 × binding buffer added and flow cytometer (Benton Dickinson, Mountain view, CA) was used to measure and analyze the apoptosis rate.

Western blotting analysis

Protein lysates from KGN cells were prepared by radioimmunoprecipitation assay buffer (RIPA) and the concentration of the lysates were determined by bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China). A total of 30 µg protein per sample were added and separated by electrophoresis on 10% sodium dodecyl sulphate-polyacrylamide gel. Then, the proteins were transferred to the polyvinylidene difluoride membranes. Blocked the membranes with 5% nonfat milk, and incubated with primary antibodies at 4℃ overnight. The next day, incubated the membranes with the specific HRP-conjugated secondary antibody for 1 h at room temperature. All the images were visualized using an ECL kit (Millipore, MA). We measured the grayscale values of the target bands and their corresponding β-actin bands separately using Image J. Then, we calculated the ratio between the grayscale intensities of each target band and its internal reference. Finally, inter-group comparisons were conducted.

RNA extraction and qRT-PCR assay

Total RNA was isolated from KGN cell line using Trizol reagent (Invitrogen, CO., Carlsbad, CA, USA), the concentration and purity of the RNA were detected, and complementary DNA (cDNA) was synthesisd as our previously described [33]. qRT-PCR was performed using SYBR Premix ExTaq™ (Takara) on the StepOne Real – Time PCR System (Applied Biosystems, USA) and the relative expression levels of the target genes were analyzed by the 2−ΔΔCt method. The primers used in this study are as follows:

GAPDH forward primer: 5’ - AAAATCAAGTGGGGCGATGCT − 3’

GAPDH reversed primer: 5’ - TGGTTCACACCCATGACGAAC − 3’

FTO forward primer: 5’ - CTT CAC CAA GGA GAC TGC TATTTC − 3’

FTO reversed primer: 5’ - CAA GGT TCC TGT TGA GCACTCTG − 3’

ANKRD1 forward primer: 5’- AGTAGAGGAACTGGTCACTGG − 3’

ANKRD1 reversed primer: 5’- TGTTTCTCGCTTTTCCACTGTT − 3’

CYR61 forward primer: 5’ - GGTCAAAGTTACCGGGCAGT − 3’

CYR61 reversed primer: 5’ - GGAGGCATCGAATCCCAGC − 3’

CTGF forward primer: 5’ - GGAAATGCTGCGAGGAGTGG − 3’

CTGF reversed primer: 5’- GAACAGGCGCTCCACTCTGTG − 3’.

Cell proliferation assay

The capacity of the KGN cells to proliferate was determined by a CCK – 8 assay kit (Dojindo, Kumamoto Prefecture, Japan). 1 × 104 cells cultured in 100 µL complete medium were seeded in a 96-well plate (per well). After incubated for 24 h in the 37 ℃, at 5% CO2, 10 µL of CCK-8 reagent was added to each well and incubated for another 2 h. Then, the cells absorbance was evaluated at 450 nm using a microplate reader (Model 550; Bio-Rad, Shanghai, China).

Immunofluorescence assay

Immunofluorescence was used to detect the expression and location of YAP1 in the KGN cells. KGN cells were seeded on coverslipes in a 6-well plate. After different treatment, the cells were washed twice with ice - cold PBS, then fixed with 4% paraformaldehyde for 0.5 h and permeabilized with 0.5% Triton X-100 (Beyotime) for 0.5 h at room temperature. Blocked the cells in 5% bovine serum albumin (BSA) for 1 h and incubated the cells with rabbit monoclonal antibody against YAP1 (1:200, Proteintech) at 4 ℃ overnight. The next day, washed the cells with PBS-T (0.1% Triton X-100/PBS) for three times, incubated the cells with anti-rabbit Alexa Fluo488 (Invitrogen) for 1 h in the dark, and incubated cells with 4’-diamidino-2-phenylindole (DAPI) for 0.5 h in the dark at room temperature. Finally, washed the cells with ice-cold PBS-T for 3 times and obtained the images using a fluorescence microscope (Olympus Inc., USA).

Statistical analysis

All experiments were repeated at least 3 times. Statistical analysis was conducted using GraphPad Prism 5 (GraphPad Software, San Diego, California, USA). Data were presented in mean ± standard error of the mead (SEM). Student’s t-test and One-way ANOVA with Turkey’s post hoc test were applied to evaluate the Group difference.