Mice and diets

MC4Rflox/+ mice (NM-CKO-200195) were purchased from the Shanghai Model Organisms (Shanghai, China). POMC-Cre mice (stock number #005965) were purchased from the Jackson laboratory (Bar Harbor, ME, USA). To obtain POMC neuron-specific MC4R knockdown and littermate wildtype (WT) mice, we crossed the MC4Rflox/+ mice with POMC-Cre mice to generate POMC-MC4Rflox/+ mice, as well as self-crossed the MC4Rflox/+ mice to generate MC4Rflox/flox mice. The POMC-MC4Rflox/+ mice were further mated with MC4Rflox/flox mice to generate the POMC-MC4Rflox/flox mice in which MC4R is selectively deleted in POMC neurons (the littermate MC4Rflox/flox: Cre− mice were used as control). Tail biopsies and brain tissue were harvested and a PCR assay was performed to verify genotyping. Besides, immunofluorescent staining assay was used to detect the knockdown of MC4R in POMC neuron.

The animals were singly housed under a standard condition with a 12:12 h light-dark cycle at 25 ℃ with free access to water. Chow (9.4% kcal from fat, #SPF-F02-001) and high-fat (60% kcal from fat, #D12492) diets were purchased from the SPF biotechnology (Beijing, China). The chow-treated mice were fed regular chow throughout the experiment. The HFD-treated mice were subjected to regular chow for the first eight weeks, followed by a HFD for three months (Supplementary Fig. 1). All animal experiments were approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University (2021-KY-0906-001).

Adeno-associated viruses (AAV)-sh-Kir2.1 injections

POMC-MC4Rflox/flox mice were anesthetized with isoflurane and placed on a stereotaxic apparatus (David Kopf Instruments, Tujunga, CA). The skull was exposed via a small incision, and a small hole was drilled (0.45-mm drill bit) into the skull. A Hamilton 5-µl syringe with a 30-gauge blunt-end needle was inserted into the brain for the delivery of Kir2.1 shRNA adeno-associated viruses (AAVs, 1 × 1012 v.g/ml, Genechem, Shanghai, China). Bilateral injections of AAVs (200 nl of AAV-sh-Kir2.1 or AAV-sh-NC) were made into the ARC of the hypothalamus (Coordinates: 1.46 mm posterior to and 0.26 mm lateral to bregma, as well as 5.80 mm below the surface of skull). Mice were allowed to recover for 10 days.

Primary hypothalamic neuron isolation and treatments

Primary hypothalamic neurons were isolated from fetal mice, embryonic day 18 using Neuron Isolation Kit, according to the manufacturer’s instructions (Miltenyi Biotec, Bergisch-Gladbach, Germany) and were cultured in neurobasal medium (Gibco). Briefly, after the pregnant mice were killed, the fetal mice were quickly removed from the mother, decapitated and the brain was isolated. The hypothalamus was dissected along the anterior border of the optic chiasm, posterior border of the mammillary body, upper border of the anterior commissure, and lateral border halfway from the lateral sulcus in the ventral side of brain. Subsequently, the neurons were isolated from hypothalamus using Neuron Isolation Kit, according to the manufacturer’s instruction. Primary neurons were infected with MC4R overexpression adenovirus or MC4R knockdown adenovirus, and cells were harvested 48 h after transfection.

Metabolic parameter detection and fat level

Oxygen consumption, carbon dioxide production, respiratory exchange ratio (RER), energy expenditure, physical activity, meal frequency, meal size, meal duration and meal interval were measured by using the CLAMS (Columbus Instruments, Columbus, OH). Total, visceral and subcutaneous fat was analyzed using Micro-CT (Bruker SkyScan 1276, Bremen, Germany).

Intraperitoneal glucose tolerance test (IPGTT)

Mice were fasted overnight and then intraperitoneally administered 20% glucose (w/v, 2 g/kg body weight). Blood was squeezed out from the tail vein and centrifuged at 4000 rpm for 15 min. Blood glucose level was measured by using a glucometer (Roche, Basel, Switzerland) at the indicated time points (0, 15, 30, 60, 90, 120 min).

Intraperitoneal insulin tolerance test (IPITT)

For the detection of plasma insulin level, mice were fasted 4 h and then intraperitoneally administered insulin (0.6 U/kg body weight). Blood was collected from the tail vein and centrifuged at 4000 rpm for 15 min. Plasma insulin was detected using the Mercodia Ultrasensitive Insulin ELISA kit (ALPCO Diagnostic) at the indicated time points (0, 15, 30, 60, 90, 120 min).

Immunofluorescence

Mice were anesthetized, and then fixed with 4% paraformaldehyde (PFA) via transcardial perfusion. Brain tissues were cryoprotected with sucrose solutions and sectioned on a cryostat (Leica, Wetzlar, Germany). Tissue sections were fixed with 4% formaldehyde for 15 min, and then permeabilized with 0.5% Triton X-100 for 20 min. After blocking with normal goat serum in 0.1% PBS-Tween for 30 min, tissue sections were incubated with primary antibodies overnight at 4 °C. The tissue sections were then incubated with Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ Plus 488 (4 µg/ml, #A32723, Invitrogen, Carlsbad, CA, USA) and Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 594 (4 µg/ml, #A-11037, Invitrogen) at 1:2000 dilution each at room temperature for 1 h. Slides were counterstained with DAPI for 5 min in the dark to show cell nuclei. Images were captured at 40 × magnification with a FluoView FV1200 confocal microscope (Olympus, Tokyo, Japan), processed and analyzed with the ImageJ software (Ver. 1.8, NIH, Bethesda, MD). Cells were manually counted in one side of the Arc nucleus in a representative image acquired for each mouse. The primary antibodies are as follows: rabbit anti-POMC antibody (1:1000, #23499S, Cell Signaling Technology Danvers, MA, USA), mouse anti-MC4R antibody (1:1000, #Sc-55567, Santa Cruz Biotechnology, CA, USA), Kir2.1 mouse monoclonal (5 µg/ml, #Ab85492, Abcam, Cambridge, UK), and c-FOS mouse monoclonal (1:800, #Ab208942, Abcam).

Quantitative RT-PCR

Tissue RNA was extracted by using the TRIzol reagent (Thermo Fisher). Complement DNA was generated with MMLV reverse transcriptase (Promega, Madison, WI). PCR was performed on an ABI 7900HT thermocycler (Thermo Fisher) after the combination of cDNA, primers and master mix. We used the 2−ΔΔCt method to analyze the relative expression of genes. The primers for MC4R are 5’- CCCGGACGGAGGATGCTAT-3’, 5’- TCGCCACGATCACTAGAATGT-3’. The primers for the housekeeping gene GAPDH are forward 5’- ACTCTTCCACCTTCGATGC − 3’ and reverse 5’- CCGTATTCATTGTCATACCAGG − 3’.

Western blot analysis

BAT, liver, soleus and hypothalamic tissues were collected from MC4R WT and KO mice fed a HFD for 13 weeks at the age of 8 weeks. After the tissues were removed, they were cut up into 1 cm3, digested in trypsin for 30 min, and then added to the medium containing serum to terminate digestion. Protein extracts were then prepared using RIPA buffer, and the concentrations were determined by using a BCA protein assay kit (Pierce, Rockford, IL, USA). Fifty micrograms of lysates were separated by SDS polyacrylamide 10% gradient gel (Sodium dodecyl sulphate/polyacrylamide gel), transferred to a polyvinylidene difluoride membrane (PVDF membrane, Millipore, Boston, MA, USA). The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline, pH 7.4, containing 0.05% Tween 20, and were incubated with primary antibodies and horseradish peroxidase-conjugated IgG antibodies (1:5000, Santa Cruz) according to the manufacturer’s instructions. The protein of interest was visualized using enhanced chemiluminescence (ECL) system (Solarbio,Beijing, China). The primary antibodies are as follows: anti-MC4R (1:2000, Sc-55567, Santa Cruz Biotechnology, Santa Cruz, CA), anti-Kir2 (1 µg/ml, Ab85492, Abcam), IR (1:1000, 07-724, Millipore), p-IR (1:1000, 44800G, Invitrogen), AKT (1:1000, 9272 S, Cell Signaling Technology, Danvers, MA, USA), p-AKT (1:2000, 4060T, Cell Signaling Technology), AgRP (1:1000, ab113481, Abcam), NPY(1:1000, D7Y5A, Cell Signaling Technology), leptin (1:1000, PA1-051,Thermo Fisher), MC1R (1:2000, Ab180776, Abcam), MC3R (1:2000, STJ27686, St John’s Labs), MC5R (1:200, AMR-025, Alomone Labs) and GLP-1(1:2000, Ab36598, Abcam).

Transcriptome analysis

MC4R overexpressed adenovirus-transfected GT1-7 cells (empty vector adenovirus-transfected GT1-7 cells were used as control) were used for transcriptome analysis. The GT1-7 cells were sent to Wuhan BGI Technology Co., Ltd. (Hubei, China) for high-throughput sequencing using the BGISEQ-500 platform. RNA differential expression analysis was performed using DESeq2 software between two different groups. Transcripts with a false discovery rate (FDR) below 0.05, and absolute fold change ≥ 2 were considered differential expression genes.

Co-immunoprecipitation assays

GT1-7 cells (1 × 107) were donated by the Clinical Center of Endocrinology and Metabolism of Shanghai Ruijin Hospital were washed with ice-cold PBS, and lysed in 20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40 supplemented with protease inhibitor PMSF on ice for 30 min. After centrifuged at 12,000 rpm for 15 min at 4℃, the supernatant was collected and 20 µl of supernatant was used as Input. The remaining cell lysates supernatant was immunoprecipitated with antibody against Kir2.1 (20 µg/ml) at 4℃ overnight. The immunocomplex was captured with protein A-agarose beads (Invitrogen, normal mouse IgG was used as negative control), and incubated for 4 h at 4℃. Then, the complex were washed with washing buffer for three times, and analyzed by Western blotting.

Statistical analysis

All statistical analyses involved use of SPSS20.0 (SPSS Inc, Chicago, IL). Data are reported as the mean ± standard deviation (SD). For 2-group comparisons of parametric data, a Student t test was performed, whereas nonparametric data were analyzed with the Mann-Whitney test. Statistical significance between multiple groups was determined by one‐way ANOVA followed by Dunnett's post hoc test or two-way ANOVA. P < 0.05 was considered statistically significant.