Sci. Pharm., Vol. 90, Pages 58: Retinoic Acid Potentiates the Therapeutic Efficiency of Bone Marrow-Derived Mesenchymal Stem Cells (BM-MSCs) against Cisplatin-Induced Hepatotoxicity in Rats

Conceptualization, M.M.A., A.M.H., B.H.M. and N.A.H.; methodology, M.M.A., B.H.M., N.M.B. and M.M.M.K.; formal analysis, M.M.A., A.M.H. and B.H.M.; investigation, M.M.A., A.M.H. and B.H.M.; data curation, M.M.A., A.M.H. and B.H.M., N.A.H.; writing—original draft preparation, M.M.A., A.M.H. and B.H.M., N.A.H.; writing—review and editing, A.M.H., B.H.M. and N.A.H.; supervision, M.M.A., A.M.H., B.H.M. and N.A.H. All authors have read and agreed to the published version of the manuscript.

Figure 1. BM-MSCs characterization. Flow cytometry histograms for BM-MSCs showing positivity for CD29, CD44 and CD106 (A) and negativity for CD34, CD14 and CD45 (B).

Figure 1. BM-MSCs characterization. Flow cytometry histograms for BM-MSCs showing positivity for CD29, CD44 and CD106 (A) and negativity for CD34, CD14 and CD45 (B).

Scipharm 90 00058 g001

Figure 2. Serum levels of liver enzymes: ALT (A) and AST (B) (iU/L) in different studied groups. All data are expressed as Mean ± SD. One-way ANOVA with Tukey post hoc test. * Significant vs. control group, # significant vs. Cis group, ‡ significant vs. Cis + BM-MSCs group and $ significant vs. Cis + RA group. ALT = alanine transaminase and AST = aspartate transaminase, Cis = cisplatin, RA = retinoic acid and BM-MSCs = bone marrow derived mesenchymal stem cells. p < 0.05 is considered significant.

Figure 2. Serum levels of liver enzymes: ALT (A) and AST (B) (iU/L) in different studied groups. All data are expressed as Mean ± SD. One-way ANOVA with Tukey post hoc test. * Significant vs. control group, # significant vs. Cis group, ‡ significant vs. Cis + BM-MSCs group and $ significant vs. Cis + RA group. ALT = alanine transaminase and AST = aspartate transaminase, Cis = cisplatin, RA = retinoic acid and BM-MSCs = bone marrow derived mesenchymal stem cells. p < 0.05 is considered significant.

Scipharm 90 00058 g002

Figure 3. Markers of oxidative stress including MDA (A), GSH (B) and catalase (C) in different studied groups. All data are expressed as mean ± SD. One-way ANOVA with Tukey pos thoc test. * Significant vs. control group, # significant vs. Cis group, ‡ significant vs. Cis + BM-MSCs group and $ significant vs. Cis + RA group. MDA = malondialdehyde and GSH = glutathione, CAT = catalase, Cis = cisplatin, RA = retinoic acid and BM-MSCs = bone marrow derived mesenchymal stem cells. p < 0.05 is considered significant.

Figure 3. Markers of oxidative stress including MDA (A), GSH (B) and catalase (C) in different studied groups. All data are expressed as mean ± SD. One-way ANOVA with Tukey pos thoc test. * Significant vs. control group, # significant vs. Cis group, ‡ significant vs. Cis + BM-MSCs group and $ significant vs. Cis + RA group. MDA = malondialdehyde and GSH = glutathione, CAT = catalase, Cis = cisplatin, RA = retinoic acid and BM-MSCs = bone marrow derived mesenchymal stem cells. p < 0.05 is considered significant.

Scipharm 90 00058 g003

Figure 4. Relative gene expression of (A) TNF-alpha and (B) NADPH oxidase genes at the level of mRNA. * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 4. Relative gene expression of (A) TNF-alpha and (B) NADPH oxidase genes at the level of mRNA. * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g004

Figure 5. Histopathological examination of liver specimens. The score of liver damage at different time intervals (3 days, 7 days and 11 days) showed significant rise in damage score in Cis and vehicle groups and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic images from control group show normal radial arrangement of hepatic cords around central veins with normal portal areas and sinusoids at 11 days from start of experiment ((B) 100× and (C) 400×). Liver sections from Cis group show disrupted hepatic cords, interstitial edema (yellow arrow) and inflammation (red arrows), diffuse hydropic degeneration in hepatocytes (blue arrows) and occluded sinusoids ((D,E) 400×). Moreover, liver specimens from vehicle group shows the same morphological findings ((F), 400×). Liver specimens from Cis + BM-MSCs group ((G) 400×), Cis + RA ((H) 400×) and Cis + RA + BM-MSCs ((I) 100× and (J) 400×) at 11 days show improved liver pictures with milder hydropic degeneration in hepatocytes detected in some sections than in untreated Cis group after 11 days. * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 5. Histopathological examination of liver specimens. The score of liver damage at different time intervals (3 days, 7 days and 11 days) showed significant rise in damage score in Cis and vehicle groups and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic images from control group show normal radial arrangement of hepatic cords around central veins with normal portal areas and sinusoids at 11 days from start of experiment ((B) 100× and (C) 400×). Liver sections from Cis group show disrupted hepatic cords, interstitial edema (yellow arrow) and inflammation (red arrows), diffuse hydropic degeneration in hepatocytes (blue arrows) and occluded sinusoids ((D,E) 400×). Moreover, liver specimens from vehicle group shows the same morphological findings ((F), 400×). Liver specimens from Cis + BM-MSCs group ((G) 400×), Cis + RA ((H) 400×) and Cis + RA + BM-MSCs ((I) 100× and (J) 400×) at 11 days show improved liver pictures with milder hydropic degeneration in hepatocytes detected in some sections than in untreated Cis group after 11 days. * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g005

Figure 6. Immunohistopathological examination for the expression of caspase-3 in liver specimens. The score of caspase-3 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group with significant attenuation Cis + RA + BM-MSCs group (A). Microscopic pictures of immunostained hepatic sections stained with caspase-3 from rats groups sacrificed at 11 days showing negative staining in control group ((B) 100×), increased positive brown expression of caspase-3 (red arrows) in hepatocytes in Cis group group ((C) 100× with high power 400× side box), Cis + vehicle group ((D) 100× with high power 400× side box), Cis + RA group ((E) 100× with high power 400× side box) and weak expression in BM-MSCs group ((F) 100× with high power 400× side box), and Cis + BM-MSCs + RA group ((G) 100× with high power 400× side box). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 6. Immunohistopathological examination for the expression of caspase-3 in liver specimens. The score of caspase-3 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group with significant attenuation Cis + RA + BM-MSCs group (A). Microscopic pictures of immunostained hepatic sections stained with caspase-3 from rats groups sacrificed at 11 days showing negative staining in control group ((B) 100×), increased positive brown expression of caspase-3 (red arrows) in hepatocytes in Cis group group ((C) 100× with high power 400× side box), Cis + vehicle group ((D) 100× with high power 400× side box), Cis + RA group ((E) 100× with high power 400× side box) and weak expression in BM-MSCs group ((F) 100× with high power 400× side box), and Cis + BM-MSCs + RA group ((G) 100× with high power 400× side box). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g006

Figure 7. Immunohistopathological examination for the expression of p53 in liver specimens. The score of p53 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections against p53 from rats groups sacrificed at day 11 showing negative staining in control group ((B) 100×), increased positive brown expression of p53 (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group (E) in contrast to treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group ((F) 400×), MSCs group ((G) 400×), to minimal expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 7. Immunohistopathological examination for the expression of p53 in liver specimens. The score of p53 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections against p53 from rats groups sacrificed at day 11 showing negative staining in control group ((B) 100×), increased positive brown expression of p53 (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group (E) in contrast to treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group ((F) 400×), MSCs group ((G) 400×), to minimal expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g007

Figure 8. Immunohistopathological examination for the expression of Bcl2 in liver specimens. The score of Bcl2 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group with significant rise in all treated groups (Cis + RA, Cis + BM-MSCs, Cis + RA+BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections for Bcl2 from rats groups sacrificed at day 11 showing minimal staining in control group ((B) 100×), increased positive brown expression of Bcl2 (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group ((E) 400×) and more upregulation Bcl2 expression in treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group ((F) 400×), MSCs group ((G) 400×), to marked expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 8. Immunohistopathological examination for the expression of Bcl2 in liver specimens. The score of Bcl2 expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group with significant rise in all treated groups (Cis + RA, Cis + BM-MSCs, Cis + RA+BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections for Bcl2 from rats groups sacrificed at day 11 showing minimal staining in control group ((B) 100×), increased positive brown expression of Bcl2 (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group ((E) 400×) and more upregulation Bcl2 expression in treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group ((F) 400×), MSCs group ((G) 400×), to marked expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. Control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g008

Figure 9. Immunohistopathological examination for the expression of IL-1beta in liver specimens. The score of Il1beta expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections against Il1beta from rats groups sacrificed at day 11 showing negative staining in control group ((B) 100×), increased positive brown expression of IL-1beta (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group (E) in contrast to treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group (F), MSCs group ((G) 400×), to minimal expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Figure 9. Immunohistopathological examination for the expression of IL-1beta in liver specimens. The score of Il1beta expression in liver at different time intervals (3 days, 7 days and 11 days) showed significant rise in its expression in Cis group and significant attenuation in all treated groups (Cis + RA, Cis + BM-MSCs and Cis + RA + BM-MSCs groups) (A). Microscopic pictures of immunostained hepatic sections against Il1beta from rats groups sacrificed at day 11 showing negative staining in control group ((B) 100×), increased positive brown expression of IL-1beta (red arrows) in hepatocytes in Cis group group at day 11 ((C) 100× and (D) 400×) and vehicle group (E) in contrast to treated groups where positive cytoplasmic brown expression (red arrows) in hepatocytes is moderate in group treated with RA group (F), MSCs group ((G) 400×), to minimal expression in group treated with MSCs & RA group ((H) 400×). * Significant vs. control group, # significant vs. Cis group, $ significant vs. Cis + MSCs group and ‡ significant vs. RA group.

Scipharm 90 00058 g009

Table 1. Primer sequence and annealing temperature of investigated genes.

Table 1. Primer sequence and annealing temperature of investigated genes.

Accession No.Primer SequenceProduct LengthAnnealing TemperatureGAPDHNM_053524.1F: TGCCACTCAGAAGACTGTGG8559R: GGATGCAGGGATGATGTTCTTNF-αNM_012675.3F: TCTTCAAGGGACAAGGCTGC10460R: CTTGATGGCAGAGAGGAGGCNADPHNM_017008.4F: TGTTGGGCCTAGGATTGTGT11960R: CTTCTGTGATCCGCGAAGGT

留言 (0)

沒有登入
gif