Figure 1. (A,B) Field symptoms of zinnia leaf spot disease. Healthy plants that were (C) inoculated with sterile water and (D,E) plants presenting symptoms on leaves due to inoculation with BRJ2 after 7 d.
Figure 2. Morphological characteristics of the BRJ2 isolate on PDA after seven days. (A) Front of a BRJ2 colony; (B) back of a BRJ2 colony. (C,D) Conidiogenous cells giving rise to conidia. (C,D) Scale bar = 10 μm.
Figure 3. Maximum likelihood (ML) tree of Nigrospora spp. based on 13 strains. Maximum likelihood analysis bootstrap support (ML ≥ 50%) and Bayesian posterior probability (PP ≥ 0.90) are shown at the nodes (ML/PP). The tree was rooted using Arthrinium malaysianum (CBS 102053). The scale bar indicates 0.08 expected changes per site.
Table 1. PCR primer sequences.
Table 1. PCR primer sequences.
Target SequencePrimerPrimer Sequence (5′-3′)ReferenceITSITS1CTTGGTCATTTAGAGGAAGTAA[13] ITS4TCCTCCGCTTATTGATATGC[14]TEF1-αEF1-728FCATCGAGAAGTTCGAGAAGG[15] EF1-986RTACTTGAAGGAACCCTTACCTUB2T1AACATGCGTGAGATTGTAAGT[16] Bt2bACCCTCAGTGTAGTGACCCTTGGC[17]Table 2. Sequence information for the strains used for multigene phylogenetic analysis in this study.
Table 2. Sequence information for the strains used for multigene phylogenetic analysis in this study.
SpeciesStrain No.GeneBank Accession NumberITSTUBTEF1-αNigrospora. bambusCGMCC3.18327 *KY385307KY385319KY385313Nigrospora. camelliae-sinenCGMCC3.18125 *KX985986KY019460KY019293Nigrospora. gorlenkoanaCBS 480.73 *KX986048KY019456KY019420Nigrospora. guilinensisCGMCC3.18124 *KX985983KY019459KY019292Nigrospora. hainanensisCGMCC3.18129 *KX986091KY019464.1KY019415Nigrospora. musaeCBS 319.34 *NR153478KY019455KY019419Nigrospora. oryzaeLC6759KX986054KY019572.1KY019374.1Nigrospora. pyriformisCGMCC3.18122 *KX985940KY019457.1KY019290.1Nigrospora. rubiCGMCC3.18326 *KX985948KY019475KY019302Nigrospora. sphaericaLC 7312KX985935KY019618KY019414Nigrospora. zimmermaniiCBS 167.26KY385308KY385318KY385312Nigrospora. singularis sp. novCGMCC 3.19335MN215793MN329956MN264032Nigrospora. vesiculariferaCGMCC 3.19333 MN215812MN329975MN264051Arthrinium malaysianumCBS 102053KF144896.1KF144988.1KF145030.1Table 3. In vitro toxicity of five fungicides against N. musae.
Table 3. In vitro toxicity of five fungicides against N. musae.
Fungicides Concentrations (ug/mL)Regression Equation of Toxicity EC50 (mg/L) Correlation
留言 (0)