Subjects

This study obtained de-identified post-mortem tissues from the Mayo Clinic Brain Bank. We analyzed two cohorts that each consisted of AD patients and of neurological normal individuals (hereafter referred to as controls). For the smaller exploratory cohort, we investigated frontal cortex samples from n = 13 AD and n = 13 controls. Available cerebellum samples from the same individuals were used to probe for effect in an AD-unaffected region (n = 12 each). For the main cohort we investigated midfrontal and superior temporal cortex samples from n = 72 AD and n = 41 control cases. Detailed characteristics of these cohorts are summarized in Tables S1 and S2, respectively.

All brains were examined in a systematic and standardized manner and obtained between 1998 and 2019. All subjects are non-Hispanic Caucasians of European descent. Available clinical information included age at death, sex, Braak tangle stage (0-VI), and Thal amyloid phase (0–5). For the AD cohort we also obtained the age at onset, and disease duration. For the main cohort, we further obtained additional information such as the APOE genotype and mini mental state examination (MMSE) scores (AD patients only). The AD cases of the main cohort were part of the M2OVE-AD (Molecular Mechanisms of the Vascular Etiology of AD) initiative and had been phenotyped in depth. Levels of apoE, Aβ40, Aβ42, tau, pT231-tau were available from three fractions (Tris-buffered saline [TBS] buffer, detergent-containing buffer [1% Triton X-100 in TBS, termed TX], and formic acid [FA] fractions) from temporal cortex tissue [32]. These parameters were used as secondary measures of interest. In addition, we used bulk transcriptome data available from the same cases to study correlations with gene expression data.

The Mayo Clinic brain bank for neurodegenerative disorders operates with approval of the Mayo Clinic Institutional Review Board. All brain samples are from autopsies performed after approval by the legal next-of-kin. Research on de-identified postmortem brain tissue is considered exempt from human subjects regulations by the Mayo Clinic Institutional Review Board.

Sample preparation

Tissues were dissected and kept frozen until protein extraction. 180–200 mg of frozen tissue were homogenized in 5 volumes of ice-cold Tris-buffered saline (TBS; 50 mM Tris [Millipore, G48311], 150 mM NaCl [FisherScientific, BP358], pH 7.4) containing phosphatase inhibitors (Roche, 4,906,845,001) and protease inhibitor cocktail (Roche, 11,836,170,001) with a Dounce tissue grinder (DWK, K885300-0002). For protein extraction, ¼ volume of a 5 × RIPA buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% deoxycholate, 1% NP-40) was added to the TBS homogenate and incubated at 4 °C for 30 min with rotation. Then, samples were centrifuged at 100,000 g for 60 min at 4 °C. The supernatant (referred to as ‘soluble’ fraction) was collected, aliquoted, flash frozen in liquid nitrogen and stored at −80 °C until use. The residual pellet was washed with 1xRIPA buffer twice and centrifuged at 100,000 g for 30 min at 4 °C. The pellet was resuspended in 2% SDS (Fisher, BP166-500) in TBS with phosphatase and protease inhibitors, sonicated for ten cycles (one cycle is 30 s ON/30 s OFF with high power level) in a Bioruptor plus sonication system (Diagenode, Belgium) at 18 °C, and boiled at 95 °C for 5 min. After centrifugation at 100,000 g for 60 min at 22 °C, the resulting supernatant (referred to as ‘insoluble’ fraction) was collected, aliquoted, flash frozen in liquid nitrogen and stored at −80 °C until use.

Gel electrophoresis and western blot

The protein concentration was measured using BCA assay (Thermo Fisher, 23,225). 20 μg protein extract was mixed with 6 × SDS-PAGE loading buffer, boiled for 5 min at 95 °C and loaded on 8–16% Tris–Glycine gels (Invitrogen, EC60485BOX). Proteins were transferred onto 0.2 μm nitrocellulose membranes (Bio-Rad, 1,620,112) or polyvinylidene fluoride membrane (PVDF) membranes (Millipore, IEVH00005). Following blocking with 5% nonfat milk (Sysco, 5,398,953) in TBS with 0.1% Tween (TBST) for one hour at room temperature (RT), primary and secondary antibodies were applied, and the blots developed with Immobilon Western Chemiluminescent HRP Substrate (Millipore, WBKLS0500). Bands were visualized on Blue Devil Lite X-ray films (Genesee Scientific, 30-810L) or with a ChemiDoc MP Imager (BioRad, Hercules, CA).

Antibodies

The following antibodies were used for immunoblot: Rabbit anti-UFM1-Ab1 (Abcam, ab109305, 1:1000), rabbit anti-UFM1-Ab2 (Sigma, HPA039758, 1:1000), rabbit anti-UFM1-Ab3 (Proteintech Group, 15,883–1-AP, 1:1000), rabbit anti-UFM1-Ab4 (LS Bio, LS-C807041, 1:1000), rabbit anti-UFM1-Ab5 (LS Bio, LS-C500000, 1:1000), mouse anti-UFSP1 (Santa Cruz Biotechnology, sc-398577, 1:1000), mouse anti-UFSP2 (Santa Cruz Biotechnology, SC-376084, 1:2000), rabbit anti-UBA5 (Proteintech Group, 12,093–1-AP, 1:2000), rabbit anti-UFC1 (Abcam, ab189252, 1:2000), rabbit anti-UFL1 (Thermo Fisher, A303-456A, 1:1000), rabbit anti-DDRGK1 (Proteintech Group, 21,445–1-AP, 1:1000), rabbit anti-CDK5RAP3 (Abcam, ab242399, 1:1000), mouse anti-β-actin (Sigma, A1978, 1:100,000), mouse anti-Vinculin (Sigma, V9131, 1:100,000), mouse anti-GAPDH (Meridian Life science, H86504M; 1:5,000,000), rabbit anti-Bip (Cell Signaling Technology, 3177, 1:5,000), rabbit anti-PERK (Cell Signaling Technology, 3192, 1:4000), rabbit anti-ATF4 (Cell Signaling Technology, 11,815, 1:2000), mouse anti-CHOP (Cell Signaling Technology, 2895, 1:2000), rabbit anti-IRE1α (Cell Signaling Technology, 3294, 1:2000), rabbit anti-Xbp1s (Cell Signaling Technology, 12,782, 1:5000), rabbit anti-ATF6 (Cell Signaling Technology, 65,880, 1:1000).

The following antibodies were used for immunofluorescence: mouse anti-CHOP (Cell Signaling Technology, 2895, 1:200), rabbit anti-Xbp1s (Cell Signaling Technology, 12,782, 1:400), γH2Ax (Cell Signaling Technology, 9718 T, 1:400).

For ELISA the following antibodies were used: rabbit anti-UFM1-Ab1 (Abcam, ab109305, 1:300), rabbit anti-UFM1-Ab2 (Sigma, HPA039758, 1:100), rabbit anti-UFM1-Ab3 (Proteintech Group, 15,883–1-AP, 1:100), rabbit anti-UFM1-Ab4 (LS Bio, LS-C500000, 1:100), rabbit anti-UFM1-Ab5 (LS Bio, LS-C807041, 1:100), mouse anti-UFSP2 (Santa Cruz Biotechnology, SC-376084, 1:50), rabbit anti-tau (DAKO, AA002402-1, 1:500), mouse anti-total tau (Invitrogen, AHB0042, 1:500), mouse anti-p-tau (PHF1, a generous gift from Dr. Peter Davies, 1:500).

In vitro deUFMylation assay

Frozen human postmortem frontal cortex was homogenized in 5 volumes of ice-cold reaction buffer (50 mM Tris–HCl pH 7.5, 50 mM NaCl) using a Dounce tissue grinder, without the addition of phosphatase inhibitors or protease inhibitor cocktails. Half of the homogenate was sonicated for 10 cycles (30 s ON/30 s OFF) using a Bioruptor Plus sonication system at high power, at 4 °C, and the resulting lysate was referred to as the “total” fraction. The remaining homogenate was subjected to RIPA extraction without phosphatase or protease inhibitors. After ultracentrifugation, the pellet was washed once with RIPA buffer to remove soluble proteins, then washed twice with reaction buffer to remove residual RIPA. Reaction buffer (in a volume equivalent to the initial homogenate) was added to the pellet, followed by sonication under the same conditions (10 cycles, 30 s ON/30 s OFF, high power, 4 °C), and this homogenate was referred to as “insoluble”. Equal volume of the total and insoluble homogenate or 0.5 µg of recombinant UFSP1 enzyme were pre-activated on ice in reaction buffer supplemented with 10 mM freshly prepared Dithiothreitol (DTT) (Sigma, D0632). The activated enzymes were then incubated with 1 µg of recombinant UFM1-GFP fusion protein for 8 h at 37 °C. Cleavage of the GFP tag from UFM1-GFP was analyzed by immunoblot. All enzymatic reactions were carried out in HyClone HyPure water (Cytiva, SH30538). UFM1-GFP and UFSP1 have been described previously [10].

Generation of gene-edited neuronal precursor cells

Neuronal progenitor cells derived from the ventral mesencephalon (ReNcell VM, Millipore, SCC008) were maintained on growth factor-reduced matrigel (Corning, CB-40230) coated plates in DMEM-F12 media (Thermo Fisher, 11,320,033), supplemented with B27 (Thermo Fisher, 17,504,044), 50 µg/ml gentamicin (Thermo Fisher, 15–750-060), and 5 U/ml Heparin (Sigma, H3149) in the presence of 20 ng/ml epidermal growth factor (EGF, Peprotech, AF-100–15) and fibroblasts growth factor (FGF, Peprotech, 100–25). Differentiation of ReN cells was performed by replacing FGF and EGF with 2 ng/ml GDNF (Peprotech, 450–10) and 1 mM dibutyryl-cAMP (Invivochem, V1846) for fourteen days [33]. All cells were grown at 37 °C, 5% CO2/air in a humidified atmosphere.

We used the Alt-R CRISPR-Cas9 system (IDT, Coralville, IA) to knock out UFM1 or UFSP2. UFM1 was further knocked out in UFSP2 KO cells to generate double knockouts (dKO). ReN cells VM were electroporated with ribonucleoprotein complex using the nucleofector P3 kit (Lonza, V4XP-3032). Single cell colonies were generated by limited dilution in 96-well plates. All clones were analyzed by PCR and western blot. We used three independent clones each to confirm our findings. For each clone, we further excluded unwanted editing by sequencing the six most likely off-target sites as identified by the Benchling biology software (2021, www.benchling.com). The sequences of gRNAs were as follows: gRNA-UFM1: GTAAGCAAACACTTACATGG; gRNA-UFSP2: AATAAGAGGAGGCCTTGATT.

Quantification of UFM1, UFSP2, total tau, and pS396/404-tau

The relative amounts of UFM1, UFSP2, tau and pS396/404-tau were measured by Meso Scale Discovery (MSD) ELISA. All samples were run in duplicates. For the UFM1 and UFSP2 MSD ELISA, 10 μg of denatured brain samples were diluted in 200 mM sodium carbonate buffer pH 9.7 overnight at 4 °C in 96-well MSD plates (MSD, L15XA-3). Plates were washed 3 times with 300 μl TBST wash buffer, blocked with 5% nonfat milk in TBST for one hour at RT, then incubated with primary antibody for UFM1 (Abcam, ab109305) or UFSP2 (Santa Cruz Biotechnology, sc-376084) diluted in 5% nonfat milk for 2 h at RT using agitation, washed 3 times with TBST, and incubated with SULFO-TAG labeled goat anti-rabbit (for UFM1, MSD, R32AB-1) or anti-mouse (for UFSP2, MSD, R32AC-1) for 1 h at RT using agitation. After the final three washing steps, 150 μl MSD GOLD Read Buffer (MSD, R92TG-2) was added to each well and the plate read on a MESO QuickPlex SQ 120 reader (MSD, Rockville, MD, USA). Lysates of UFM1 or UFSP2 KO ReN cells were used as negative controls.

Levels of total tau were determined by the sandwich MSD ELISA using a polyclonal total tau antibody (DAKO, A0024) as a capture antibody and a monoclonal total tau antibody (TAU-5, Thermo, AHB0042) as a detection antibody. Levels of phosphorylated (pS396/404) tau were determined by a MSD sandwich ELISA using a polyclonal total tau antibody (DAKO, AA002402-1) as a capture antibody and a monoclonal pS396/404-tau antibody (PHF1) as a detection antibody.

Cell treatments, staining and microscopy

Neuronal progenitor cells were plated on matrigel coated 96-well plates (PerkinElmer, 6,055,302) and differentiated for 14 days. DNA damage was induced with 10 µM etoposide (Cayman Chemical, 12,092–25) for analysis of γH2Ax immunostaining and with 100 µM etoposide or 10 µM bleomycin (Sigma, B1141000) for cell viability analysis. ER stress was induced by treatment of cells with 10 µg/ml tunicamycin (Sigma, T7765) or 1 µM thapsigargin (Santa Cruz Biotechnology, sc-24017).

For immunostaining, cells were fixed with 4% paraformaldehyde (Thermo Scientific Chemicals, J19943.K2) for 10 min, washed with PBS (Boston Bioproducts, BM-220) three times before permeabilization with 0.1% Triton X-100 in PBS for 10 min at RT. After blocking with 10% normal goat serum (Invitrogen, 16,210,072) in PBS, cells were stained with γH2AX (Cell Signaling Technologies, 9718, 1:400), or Xbp1s (Cell Signaling Technologies, 40,435, 1:400), and CHOP (Cell Signaling Technologies, 2895, 1:200) antibodies for 1.5 h, followed by secondary antibodies (donkey anti-rabbit IgG Alexa Fluor 488, donkey anti-mouse IgG Alexa Fluor 568, Thermo Fisher Scientific, A21206, A10037, 1:1000) for 1 h at RT. Nuclei were counterstained with Hoechst 33,342 (1:5000 in PBS). For cell viability staining, a LIVE/DEAD Assay Kit (Invitrogen, L32250) was used according to the manufacturer’s instructions.

Imaging plates were imaged on an Operetta CLS system (PerkinElmer, Waltham, MA) with a 20 × water objective using at least 4 fields per view per well (no gaps). Raw images were processed using the built-in Harmony software (version 4.9). Nuclei were identified based on the Hoechst staining and defined as regions of interest using the standard analysis building block. The mean fluorescence intensity of γH2AX, Xbp1s or CHOP was recorded for each nucleus and averaged. At least 1000 cells per genotype and condition were measured per experiment. Live cells were identified by a linear classifier that was developed using the integrated Phenologic machine learning module trained with intensity data for the live dye.

Statistical analysis

Continuous variables were summarized with the sample median and range. Categorical variables were summarized with number and percentage. Comparisons of subject characteristics between AD patients and controls were made using a Wilcoxon rank sum test (continuous and ordinal variables) or Fisher’s exact test (categorical variables). Unadjusted pair-wise correlations between variables were assessed using Spearman’s test of correlation; p values below 0.05 were considered statistically significant in these exploratory analyses.

Comparisons of UFSP2 and UFM1 between AD patients and controls were made using unadjusted and age/sex-adjusted linear regression models. Soluble UFSP2 was examined on the square root scale in all analyses owing to its skewed distribution. Regression coefficients (denoted as β) and 95% confidence intervals (CIs) were estimated and are interpreted as the increase in mean UFSP2, or UFM1 (on the square root scale for soluble UFSP2) for AD cases compared to controls. In order to adjust for multiple testing for the primary comparisons of UFSP2 and UFM1 between AD patients and controls, we utilized a Bonferroni correction separately for the temporal and frontal cortices and separately for each outcome, after which p-values < 0.025 were considered as statistically significant.

In the separate groups of controls and AD patients, associations of UFSP2 and UFM1 with clinical and disease parameters were evaluated using unadjusted and multivariable linear regression models, Multivariable models for controls were adjusted for age, sex, Braak stage, and Thal phase, while multivariable models for AD patients were adjusted for age, sex, presence of APOE ε4, Braak stage, and Thal phase. β coefficients and 95% CIs were estimated and are interpreted as the increase in mean UFSP2 (on the square root scale when examining soluble UFSP2) corresponding to presence of the given characteristic (categorical variables) or a specified increase (continuous variables). Continuous variables were examined on the untransformed, square root, cube root, or natural logarithm scale in regression analysis (Table S3). In order to examine associations of UFSP2 and UFM1 with clinical and disease parameters in the overall group of all subjects, we combined results for the separate AD and control groups using a random-effects meta-analysis [34]. We adjusted for multiple testing as follows: For the association analysis assessing correlations of UFM1 and UFSP2 with each other as well as with age, sex, APOE ε4, Braak stage, Thal phase, pS396/404-tau, and total tau, we applied a Bonferroni correction for multiple testing separately for each patient group, cortex, and fraction, after which p-values < 0.01 (controls and all subjects) and < 0.0071 (AD patients) were considered as statistically significant.

All statistical tests were two-sided. Spearman’s analysis and Wilcoxon rank sum tests were performed using GraphPad Prism (version 10.0.0, Boston, MA, USA). All other statistical analysis was performed using R Statistical Software (version 4.0.3; R Foundation for Statistical Computing, Vienna, Austria).