Reagents

LPS (E. coli, O127:B8) was purchased from Sigma (Shanghai, China) and was prepared in normal saline. M-CSF (APA090Mu61, Cloud-Clone Corp., Wuhan, China) was used to prepare bone marrow-derived macrophages (BMDMs) in PBS (BC-BPBS-01, Bio-Channel, Nanjing, China). Doxycycline (DOX, HY-N0565, Shanghai, China) and MG132 (HY-13259, Shanghai, China) were purchased from MedChemExpress and prepared in dimethyl sulfoxide (DMSO). Echinomycin (11,049; Cayman, US) was purchased from Cayman Chemical and prepared in DMSO. Recombination thrombomodulin (rTM) was purchased from MedChemExpress (HY-P70724A; Shanghai, China) and prepared in normal saline.

Patient samples

Peripheral blood samples from sepsis patients (n = 6) and healthy controls (n = 6) were collected from the Affiliated Hospital of Xuzhou Medical University between November 2022 and April 2023. Sepsis was identified according to the 2014 American Society of Critical Care Medicine/European Society of Critical Care Diagnostic criteria for sepsis. Informed consent was obtained according to the principles expressed in the Declaration of Helsinki, and the study was approved by the Ethics Committee of Xuzhou Medical University (ethical approval number: XYFY2022-KL442-01).

Mice

C57BL/6 and Pfkmf/+ mice were obtained from GemPharmatech Co., Ltd. (Nanjing, China). LyzCre/+ mice were a kind gift from Professor Hui Wang (Xuzhou Medical University, Xuzhou, China). Heterozygous Pfkmf/+; LyzCre/+ mice were generated by mating Pfkmf/+ mice with LyzCre/+ mice. The knockout mice were backcrossed onto a C57BL/6 background for three generations to eliminate off-target effects, and homozygous Pfkmf/f; LyzCre/+ mice were obtained by mating heterozygous mice. Mice were maintained and housed under specific pathogen-free (SPF) conditions. All mouse strains were genotyped by PCR using the following primers: the wild-type allele (306 bp), GCCGATGACTACATCATAGGTACTGC; the knockout allele (411 bp), TTCACGCTGATGCTCACGCAT. All animal procedures were performed according to the Guide approved by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Approval No. 202202A021).

Sepsis models

Eight- to ten-week-old male C57BL/6 mice or Pfkmf/f; LyzCre/+ mice were used, and the mice were acclimatized for 7 days before modeling. For the LPS-induced sepsis model, mice were intraperitoneally (i.p.) injected with LPS (20 mg/kg, Sigma‒Aldrich). For the rTM treatment experiment, the mice were injected (i.p.) with 1 μg/kg rTM 30 min before LPS injection. Twelve- to 14-week-old male C57BL/6 mice or Pfkmf/f; LyzCre/+ mice were used to establish a cecal ligation and puncture (CLP) model as previously described [3]. The sham group underwent the same procedure except for CLP. Twenty-four hours after the operation, the mice were sacrificed to obtain serum, lung, and liver samples for antioxidant activity measurements and histological observation. Mice in the control group were intraperitoneally injected with PBS. Mortality was recorded every day after injection.

Isolation of peripheral blood mononuclear cells (PBMCs)

PBMCs were isolated by density gradient centrifugation over Percoll (P8370, Beijing Solarbio Science & Technology Co., Ltd., China) according to the manufacturer’s protocol. The cells were stained with anti-human CD14-FITC (Cat: 301,803; Biolegend, US), and the human monocytes were sorted by flow cytometry. Then, the same number of monocytes were lysed with 1% SDS and subjected to Western blotting.

Datasets and acquisition

To explore the protein expression level of PFKM in innate immune cells. The PFKM expression data for different types of cells were downloaded from the Human Protein Atlas (HPA, http://www.proteinatlas.org). The ROC curve of PFKM was obtained from the BIDOS analysis tool online (http://www.swmubidos.com), and the data were obtained from the GEO database (http://www.ncbi.nlm.nih.gov/geo; GSE28750, GSE95233). For the analysis of PFKM expression in whole blood samples from sepsis survivors, sepsis non-survivors, and healthy controls, data were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo; GSE54514).

Cells and culture conditions

RAW264.7 and HEK-293 T cells were purchased from FuHeng (FuHeng Cell Center, Shanghai, China) and cultured in DMEM (BC-M-005, Bio-Channel, Nanjing, China) supplemented with 10% fetal bovine serum (FBS) (16,000–044, Gibco, US) and 1% penicillin and streptomycin (100 μg/mL; 15,140–122, Gibco, USA). Mouse BMDMs were cultured in DMEM supplemented with 10% FBS, 1% penicillin, 1% streptomycin, and M-CSF at 20 ng/mL. All cells were cultured at 37 °C with 5% CO2.

Western blotting

Western blotting was performed as previously described [28]. Briefly, the cells were washed with PBS, lysed with 1% SDS, separated by 8% SDS-PAGE (M00662, GenScript, Nanjing, China), and transferred to NC membranes (B500, Applied Biological Materials, Inc., Canada). The antibodies used are listed in Supplemental Table S1.

RNA extraction and real-time RT-PCR

Total RNA was isolated with TRIzol Reagent (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The collected RNA was reverse-transcribed to cDNA using 5 × All-In-One RT MasterMix (G490, Abm, Canada). The real-time RT-PCR assay was then performed using LightCycler® 480 SYBR® Green I Master Mix (04887352001, Roche, US) on a LightCycler® 480 II (Roche, US). The relative abundance of genes was calculated by using the 2−ΔΔCT formula, with β-actin serving as an internal control. The sequences of the real-time RT-PCR primers are provided in Supplemental Table S2.

Dot blot

Total RNA was isolated with TRIzol Reagent (Vazyme) and then mixed with a triple volume of RNA incubation buffer, which was prepared with methanamide (CAS:74-89-5): methanol (CAS:67-56-1):10 × MOPS (M1010, Beijing Solarbio Science & Technology Co., Ltd., China) at 66:21:13. The RNA samples were degenerated at 65 °C for 5 min and then cooled on ice. The samples were mixed with an equal volume of 20 × SSC (3 M NaCl and 0.3 M trisodium citrate) and then loaded onto nylon membranes after they were infiltrated with water and briefly rinsed with 10 × SSC. The membranes were treated with an ultraviolet lamp for 30 min and then washed with PBST 3 times. Afterward, the membranes were blocked with 5% skim milk (VIC141, Vicmed, Xuzhou, China) and immunoblotted with an anti-m6A antibody (1:2000; 68,055-1-Ig, Proteintech, US) and an anti-mouse antibody (1:5000; SA00001-1, Proteintech, US). The bands were imaged with a ChemiDoc™ Touch Imaging System (Bio-Rad, US) and analyzed with Image Lab 5.1 (Bio-Rad, US). Methylene blue was used to display the total loading amount of RNA samples as previously described [29].

MeRIP

A total of 100 μg of RNA extracted by TRIzol® Reagent (15,596,026, Invitrogen, US) was added to 500 μL of MeRIP buffer (150 mM NaCl, 10 mM Tris–HCl, 0.1% NP-40, pH = 7.5) and incubated with 1 μL of rabbit IgG (SA00001-2, Proteintech, US) for 30 min. Then, the IgG (Proteintech, US) was removed by Pierce™ Protein A agarose (20,334, Thermo Scientific, US) and Pierce™ Protein G agarose (20,397, Thermo Scientific, US) to obtain precleaned lysates. The lysates were incubated with rabbit IgG or a m6A antibody (Proteintech) for 3 h at 4 °C with rotation. IgG- or m6A-bound RNA was collected with A/G beads (Thermo Scientific) and isolated with TRIzol® Reagent (Invitrogen). Finally, the RNA level of PFKM was measured by real-time RT-PCR. The sequences of the primers used are provided in Supplemental Table S3.

Histology and tissue injury scoring

Lung sections were stained with hematoxylin and eosin (H&E) and observed under a light microscope. The morphological changes in the lung tissue were scored as described previously [3] based on the presence of exudates, hyperemia/congestion, and infiltration of inflammatory cells.

Biochemical analysis

TNF-α (430,904, BioLegend, USA), IL-1β (MLB00C, R&D, Minnesota, USA), IL-6 (1,210,602, Dakewe, Shenzhen, China), and IL-27 (438,707, BioLegend, USA) were measured using an ELISA kit according to the manufacturer’s instructions. The level of NO was measured using a nitric oxide assay kit (S0021S; Beyotime, Shanghai, China). The supernatants of the cells were collected and stored at -80 °C until assayed.

Extracellular acidification rate (ECAR)

BMDMs were seeded into an Agilent Seahorse XFe24 Cell Culture Microplate (102,342–100; Agilent Technologies, USA) at a density of 8 × 104 cells per well and cultured overnight. RAW264.7 cells were seeded at a density of 4 × 104 cells per well and cultured overnight at 37 °C with 5% CO2. The cells were treated with normal saline, 100 ng/mL LPS, 2 μg/mL rTM, or a combination of LPS (100 ng/mL) and rTM (2 μg/mL) for 24 h before extracellular flux analysis was performed. The cells were washed with PBS twice, and the ECAR was measured with a Seahorse XFe24 Analyzer (Agilent Technologies, USA) as previously described [30]. The ECAR was normalized to the cell number and calculated by Wave software version 2.6.3 (Agilent Technologies, USA).

Plasmid, lentivirus, and transfection

The HIF-1α (XM_036157196.1) overexpression plasmid was subcloned and inserted into the pLVX-TetOne-Puro vector with a Flag tag. The METTL3 (NM_019721) plasmid was purchased from YouBio (Hunan, China). METTL3 cDNA was amplified, subcloned, and inserted into the pLVX-TetOne-Puro vector with an HA tag. The pLVX-TetOne-Puro vector was a gift from Professor Feng Guo (Xuzhou Medical University, Xuzhou, China). The murine PFKM cDNA was amplified, cloned, and inserted into the pLVX-IRES-Zsgreen1 vector. Lentiviruses were generated, and stable cell lines were established, as described previously [30].

The siRNA against METTL3 was purchased from GenePharma (Shanghai, China), and the sequences are listed in Supplemental Table S4. HEK-293 T and RAW264.7 cells were transfected with the indicated plasmid DNA or siRNA utilizing jetPRIME transfection reagent (0000001762, Polyplus, France) or siRNA Transfection Reagent (101,000,028, Polyplus, France) respectively, according to the manufacturer’s instructions.

Statistical analysis

For the survival curve, experiments were performed 3 times, and the data were combined. All the other in vivo and in vitro experiments were performed at least twice. All of the values are presented as the mean ± SD. GraphPad Prism 8.0.1 (GraphPad Software, Inc., La Jolla, CA, USA) was used for statistical analysis. One-way ANOVA was used for comparisons among the different groups, unpaired two-tailed Student’s t-tests were used for comparisons between two groups, and the Shapiro–Wilk test was used for normality of residuals. The log-rank (Mantel-Cox) test and the Gehan-Breslow-Wilcoxon test were used to compare the differences in survival rates between groups. Differences were considered significant at *P < 0.05, **P < 0.01 and ***P < 0.001.