Cell culture

A172 cells, a human malignant glioma cell line (DS Pharma Biomedical Co., LTD, Osaka, Japan) were grown in an RPMI-1640 medium (Sigma-Aldrich, St. Louis, MO, USA). The culture medium was supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 µg/ml streptomycin (Sigma-Aldrich). The cells were cultured at 37 °C and in a humidified atmosphere with 5% CO2.

Immunocytochemistry

A172 cells were cultured on φ35 mm type I collagen-coated glass bottom dishes (AGC Techno Glass Co., Ltd., Shizuoka, Japan) and fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 15 min. Next, cells were washed with PBS, permeabilized with PBS plus 0.3% TritonX for 10 min, and blocked with PBS plus 5% bovine serum albumin for 1 h at room temperature. Cells were then reacted with primary antibodies overnight at 4 °C. The primary antibodies used were anti-TOMM20 (1:200, D8T4N, Cell Signaling Technology Inc. (CST)) and anti-layilin (1:100, C7, Santa Cruz, Dallas, TX, USA). The cells, washed with PBS, were then reacted with goat anti-mouse IgG antibodies labeled with AlexaFluor488 (Invitrogen, Carlsbad, CA, USA) and goat anti-rabbit IgG antibodies labeled with AlexaFluor 568 (Invitrogen) for 1 h at room temperature. Finally, cells were stained with DAPI and coverslips were applied using ProLong Glass antifade mountant (Invitrogen). Super-resolution images of the cells were obtained by LSM900 Airyscan super-resolution system (Carl Zeiss, Jena, Germany). Z-stack images were obtained at 0.19 μm intervals. To analyze the colocalization of layilin and TOMM20, we employed orthogonal projections with Fiji software [26].

RNA interference

A172 cells were transfected with 200 pmol of siRNA per 100 mm dish using Lipofectamine RNAiMAX (Invitrogen). Two different siRNA sequence were employed to target human layilin mRNA: siL1 (nucleotides 1019–1043, AAGCUGCCUUGAAUCUGGCCUACAU) and siL2 (nucleotides 1564–1588, CACAGAAGGUCUAUGAACAAGCUUA) based on NM_001258390.1 (Invitrogen). As a negative control, A172 cells were similarly transfected with a control siRNA (siC, Stealth™ RNAi Negative Control Medium GC Duplex, Invitrogen).

Western blotting

The cultured A172 cells, collected and washed with PBS, were sonicated in a lysis buffer composed of 20 mM Tris-HCl, 250 mM NaCl, 1% NP-40, 1 mM dithiothreitol, and a protease inhibitor cocktail (Roche, Basel, Switzerland). Following centrifugation, the supernatants were used as whole-cell protein samples. Western blotting was conducted as previously described [9]. The protein samples, separated using 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, were subsequently transferred onto polyvinylidence difluoride membranes. Goat polyclonal antibodies against human layilin (R&D Systems Inc., Minneapolis, MN, USA), mouse monoclonal antibodies against human BAD (SantaCruz, Dallas, TX, USA), BAK (SantaCruz), BAX (SantaCruz), BIM (SantaCruz), BCL-2 (SantaCruz), BCL-XL, (SantaCruz), and β-actin (Sigma) were used as primary antibodies. Additionally, rabbit monoclonal antibodies against human cleaved CASP-3 (abcam, Cambridge, UK), PARP1 (abcam), and CASP-7 (CST, Danvers, MA, USA), as well as rabbit polyclonal antibodies against human cleaved CASP-6 (CST) were used as primary antibodies. Horseradish peroxidase (HRP)-conjugated rabbit anti-goat IgG antibodies (Agilent/DAKO, Santa Clara, CA, USA), anti-mouse IgG antibodies (CST), and anti-rabbit IgG antibodies (CST) were used as secondary antibodies. The bound antibodies were visualized using ImmunoStar® LD (Fuji Film, Osaka, Japan).

RNA extraction, reverse transcription, and quantitative PCR (qPCR)

RNA extraction and RT-PCR were conducted as previously outlined [27]. To summarize, RNA extraction and purification from A172 cells, as well as reverse transcription of the RNA samples, were carried out using RNeasy (Qiagen, Venlo, The Netherlands) and High-Capacity cDNA Reverse Transcription Kits (Life Technologies, Rockville, MD, USA), respectively, following the manufacturer’s instructions. qPCR was performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster city, CA, USA). To measure mRNA levels for layilin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a mixture containing 2 µg of total RNA-derived cDNA, 300 nM of each forward and reverse primer, and Power SYBR® Master Mix (Applied Biosystems) was subjected to qPCR. The nucleotide sequences of the primers are as follows: layilin: 5’-CACAGCCTGCCAGGACCTTTA and 5’-TGCACCGGTCATCATTCCA, while GAPDH: 5’-TGGTATGGTGGAAGGACTCA and 5’-ATGCCAGTGAGCTTCCCGTT. For the measurement of mRNA for BAD and BCL-2, a mixture of 2 µg of total RNA-derived cDNA, a solution of TaqMan® Gene Expression Assays (Hs00188930_m1 and Hs04986394_s1, respectively, Applied Biosystems), and TaqMan® Gene Expression Master Mix (Applied Biosystems) were subjected to qPCR. The thermal cycling conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s.

Assessment of mitochondrial membrane potential MT-1 staining

The fluorescent dye MT-1 used in this study is a cell-permeable cation that selectively accumulates in mitochondria in the presence of a ΔΨm gradient. Therefore, recently, dyes of this class are commonly used to assess ΔΨm, similarly to TMRE and JC-1 [28, 29]. Specifically, mitochondrial membrane potential was assessed using MT-1 MitoMP Detection Kit (DOJINDO LABORATORIES, Kumamoto, Japan), according to the manufacturer’s instructions. A172 cells, which had been transfected with siL-1, siL-2 or siC (8.0 × 104 cells) in RPMI containing 10% FBS, were seeded onto 35 mm glass-based dishes (ASAHI GLASS, Tokyo, Japan). After a 24 h incubation, the culture medium was replaced with serum-free RPMI containing MT-1. Following a 30 min incubation, the cells were washed with Hanks’ balanced salt solution (HBSS) and expose to serum-free RPMI containing 5 µM carbonyl cyanide p-trifluoromethoxyphenyl hydrazone (FCCP) of a protonophore for 30 min. Subsequently, the cells were washed with HBSS and fixed in PBS containing 4% paraformaldehyde. The MT-1 signal was visualized using a fluorescence microscope (BIOREVO (BZ-9000), KEYENCE, Jena, Germany). The fluorescence intensity of MT-1 in each pixel was quantified using the BZ-II Analyzer Ver. 1.42 (KEYENCE). The brightness levels were calculated by summing the fluorescence intensity from all the pixels.

Annexin V and propidium idodide (PI) assay

A172 cells, seeded onto a 96 well plate (Corning Inc., Corning, NY, USA), were transfected with siL-1, siL-2 or siC (7.5 × 103 cells) in RPMI containing 10% FBS. After 24 h, the culture medium was replaced RPMI with/without 50 µM STS. Three hours later, cell membrane-bound Annexin V and DNA-bound PI were assessed using RealTime-Glo™ Apoptosis and Necrosis Assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Cell membrane-bound Annexin V is detected with a luminescence signal, and DNA-bound PI is detected with a fluorescent signal using a microplate reader (Varioskan LUX, Thermo Fisher Scientific Inc., Waltham, MA, USA).

Detection of fragmented DNA

DNA fragmentation was assessed using the ApopLadder Ex™, Apoptotic DNA Fragments Extraction Kit (Takara, Shiga, Japan), following the manufacturer’s instructions. Isolated fragmented DNA from cells was then subjected to agarose gel electrophoresis. The DNA within the gels, was made visible through ethidium bromide staining and exposure to ultraviolet light, were photographed, after which photographs were taken.

Statistical analysis

Statistical analysis involved using the student’s t-test and one-way analysis of variance, followed by Tukey’s honest significant difference post hoc test for multiple comparisons to determine statistical differences. A significant level of p < 0.05 was adopted to identify statistically significant results.