Establishment of TAC-induced HF mouse model

C57BL/6 mice (male, weight 22–24 g; 8-week-age-old) were purchased from Animal Centre of Nanjing Medical University. Mice were then randomly divided into the sham group (n = 6) and TAC group (n = 10). After anaesthetizing mice with isoflurane, sternotomy was performed along sternum midline but did not exceed the level of the second rib. After carefully separating thymus above aortic arch, a 27-G needle was placed between the left common carotid artery and truncus brachiocephalicus, and then needle and the aortic arch were tightly ligated with 7–0 nylon suture. Withdrew the needle and sutured the sternum and skin by 5–0 nylon suture. Mice in sham group underwent the same procedures as TAC group without constricting the aorta. 7 mice in the TAC group survived 6 weeks later and together with 6 mice in the sham group were sacrificed for the following analysis after the echocardiography examination.

Echocardiography

Echocardiography examination was performed 6 weeks after TAC surgery. The mice were anesthetized with 1.5% isoflurane. Left ventricular end-systolic dimension (LVDs) and left ventricular end diastolic dimension (LVDd) were measured under M-mode echocardiography using a 30-MHz probe (Vevo 3100 System, Canada). The left ventricular ejection fraction (LVEF, %) and left ventricular fractional shortening (LVFS, %) were also calculated.

Histological analysis

Heart samples were collected at 6 weeks after TAC surgery. The hearts were fixed with 4% paraformaldehyde, embedded into paraffin and then sectioned into pieces of 5 μm. Hematoxylin-eosin (G1120, Solarbio, China) and wheat germ agglutinin (WGA, W7024, Thermo Fisher, USA) staining were then performed according to the manufacturer’s instructions. Images of each sample were obtained at 40×magnifications of 5 random fields and the cardiomyocyte surface areas were calculated by Image J software (NIH).

Cell culture and treatment

Primary cardiac cells were isolated from 1- to 3-day-old C57BL/6 mice. After being anesthetized with 4% isoflurane, the hearts of neonatal mice were excised, washed and minced in Hank’s balanced salt solution (HBSS, H1025-500, Solarbio, China). Then cardiac tissues were incubated with trypsin (40101ES25, Yeasen, China) and collagenase II (LS004176, Worthington-biochem, USA) at 37 °C for 1 h and washed with complete Dulbecco’s modified Eagle’s medium (DMEM, 11965092, Gibco, USA) and centrifuged at 1000 rpm for 5 min. Resulting cells were filtered through a 40 μm-cell strainer and plated onto a 10-cm dish. Given the differential attaching time for myocytes and non-myocytes, neonatal mouse cardiac fibroblasts (NMCFs) were obtained at about 1 h incubation in the 10-cm dish and cultured with fresh complete DMEM and harvested for RNA extraction at passage 2 or 3. Neonatal mouse cardiomyocytes (NMCMs) were obtained by differential attachment for 1 h to remove NMCFs and cultured in complete DMEM at 37 °C in 5% CO2, 21%O2 for the following experiments. To evaluate the roles of DDR and HMGB1 during cardiac hypertrophy, Angiotensin II (Ang II, 4474-91-3, Sigma-Aldrich, USA) was applied to establish in vitro model of cardiac hypertrophy. In detail, after starvation for 12 h, NMCMs were cultured with Ang II (100 nM) for 12 h, 24 h, 36 h and 48 h and then collected for the following experiments. For NMCMs treated with ATM inhibitor, NMCMs were pretreated with KU55933 (10 µM, HY-12016, MedChemExpress, China) for 1 h before Ang II exposure. Mouse cardiac microvascular endothelial cells (MCMECs, CP-M129, Pricella, China) were cultured in the Endothelial Cell Medium (1001, Sciencell, USA) and harvested for extracting RNA at passage 2.

Small interfering RNA (siRNA) transfection

To identify the efficiency of AK144717 knockdown, NMCMs were transfected with siRNAs targeting AK144717 (si-AK144717, 40 nM) or negative control siRNAs (NC, 40 nM) via Lipofectamine 3000 (L3000015, Invitrogen, USA) according to the manufacturer’s instructions. After incubation for 6 h, si-RNAs were removed and NMCMs were cultured in the fresh serum-free medium (SFM) and AK144717 expression was checked by qRT-PCR at 24 h, 36 h and 48 h after transfection. To identify the efficiency of HMGB1 knockdown, NMCMs were transfected with siRNAs targeting HMGB1 (si-HMGB1, 40 nM) or NC and qRT-PCR analysis were applied to check HMGB1 expression at 12 h, 24 h and 36 h after transfection. To evaluate the roles of AK144717 in cardiac hypertrophy, NMCMs were divided into 4 groups: NC, Ang II + NC, si-AK144717 and Ang II + si-AK144717 group. For NC or si-AK144717 group, NMCMs were treated as described above and harvested for subsequent analysis at 48 h after transfection. In Ang II + NC and Ang II + si-AK144717 group, NMCMs were first incubated with the medium containing NC or si-AK144717 for 6 h and cultured in the SFM for another 6 h, which were then stimulated with Ang II (100 nM) for 36 h. To evaluate the necessity of HMGB1, NMCMs were divided into 4 groups: Ang II + NC, Ang II + si-AK144717, Ang II + si-HMGB1 and Ang II + si-AK144717 + si-HMGB1 group. NMCMs in Ang II + NC, Ang II + si-AK144717 and Ang II + si-HMGB1 group were treated as described above. NMCMs in Ang II + si-AK144717 + si-HMGB1 (Ang II + si-AK + si-HMGB1) group were first incubated with the medium containing si-AK144717 for 6 h, then the medium containing si-HMGB1 for another 6 h, and finally stimulated with Ang II for 36 h. All siRNAs were manufactured by GenePharma Company (China). The siRNA sequences used were listed in Supplementary Table 1.

Quantitative RT-PCR (qRT-PCR)

Total RNAs were extracted from tissues or cells by Trizol (RC202-01, Vazyme, China). The nuclear and cytoplasmic RNA was isolated and extracted by the Cytoplasmic & Nuclear RNA Purification Kit (NGB-37400, Norgen Biotek, Canada). The concentration and purity of extracted RNA was examined by a spectrophotometer (NanoDrop-2000, Thermo Fisher, USA). 1000 ng RNA was reverse-transcribed to cDNA and qRT-PCR was performed on the QuantStudio 3 real-time PCR system (Thermo Fisher, USA) with the SYBR Green (11203ES50, Yeasen, China) according to the manufacturer’s instructions. 18s ribosomal RNA (18s) was the reference gene for the expression of target genes. The primers used in this article are listed in Supplementary Table 1.

Western blot

Western blot was performed according to the standard protocol as previously described [34]. The nuclear and cytoplasmic proteins were separated and extracted with the Nuclear and Cytoplasmic Extraction Kit (78835, Thermo Fisher, USA) following the manufacturer’s instruction. The oxidized HMGB1 was separated by non-reducing SDS-PAGE and immunoblotted with anti-HMGB1 antibody. The antibodies included in the article were listed in Supplementary Table 2.

Enzyme linked immunosorbent assay (ELISA)

The concentrations of HMGB1 in the NMCM culture supernatants were determined with the mouse/rat HMGB1 ELISA Kit (ARG81310, Arigo, China) according to manufacturer’s protocols.

Immunoprecipitation (IP) and co-immunoprecipitation (co-IP) assay

NMCMs were lysed in the lysis buffer (P0013, Beyotime, China) containing phenylmethylsulfonyl fluoride (PMSF, ST506, Beyotime, China) and deacetylase inhibitor cocktail (P1112, Beyotime, China) on ice for 30 min and centrifuged at 14,000 rpm for 10 min at 4 °C. BCA method was applied to measure the concentrations of samples. For IP assay, antibodies of HMGB1 or acetylated-lysine (Ac-lysine) or phosphorylated serine or threonine phosphor-(Ser/Thr) and IgG were added to samples overnight at 4 °C. For co-IP assay, antibodies of HMGB1, SIRT1 and appropriate Ig G were added to samples overnight at 4 °C. The mixtures were then incubated with A/G magnetic beads (88802, Thermo Fisher, USA) at room temperature for 1 h. Beads were separated with samples by the magnetic frame and washed with lysis buffer for three times. Immune complexes pulled down by magnetic beads were eluted by loading buffer containing SDS (P0015A, Beyotime, China) and resulting proteins were then checked by Western blot.

Cell immunostaining

NMCMs were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.2% Triton X-100 for 20 min. To detect cardiac hypertrophy, after blockage with 1% BSA, NMCMs were incubated with mouse anti-α-actinin (GB12555, Servicebio, China) overnight at 4 °C. The cells were washed with PBS for 5 min for three times and incubated with fluorescein isothiocyanate (FITC, 33207ES60, Yeasen, China) for 4 h at room temperature on the next day. The nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI, 40728ES03, Yeasen, China) for 3 min. Images were captured by the fluorescence microscope (Axio Vert A1, Zeiss, Germany) and analysed for the surface area of cardiomyocytes by Image J software (NIH). To detect the DDR, the DNA Damage Assay Kit by γ-H2AX Immunofluorescence (C2035S, Beyotime, China) was applied in accordance with the manufacturer’s instructions and images were captured by the fluorescence microscope and analysed for the mean immunofluorescence intensity of γ-H2AX in the nucleus of cardiomyocytes by Image J software.

RNA pull-down assay

The templates for in vitro transcription were amplified by PCR and the PCR products were examined with agarose gel electrophoresis. The primers containing the T7 promoter sequence (TAATACGACTCACTATAGGG) for the amplification of AK144717 sense and antisense chains were listed in the Supplementary Table 1. The biotin-labelled AK144717 sense probes and anti-sense probes were synthesized by the RNAmax-T7 biotin-labeled transcription kit (C11002, Ribo, China). RNA pull-down assay was conducted by using Magnetic RNA-Protein Pull-Down Kit (20164, Thermo Fisher, USA) in accordance with the manufacturer’s instructions. The lysates of NMCM were collected and added into tubes containing sense probe-coated beads or anti-sense probe-coated beads, which were then incubated at 4 °C for 1 h. The magnetic beads were washed and eluted to collect the protein samples which were later analysed by mass spectrometry and western blot analysis.

LC-MS/MS analysis

Protein samples pulled down by AK144717 probes were first separated by SDS-PAGE and visualized by Coomassie blue staining, among which the interacting proteins of AK144717 antisense probes were used as a negative control. The LC-MS/MS analysis was then carried out by OE Biotech Co., Ltd (China). Finally, we screened out the substrate proteins that could bind to AK144717 according to the function and the mass of detected proteins.

RNA immunoprecipitation (RIP)

RIP was carried out by using Magna RIP RNA-binding protein immunoprecipitation kit (17–700, Millipore, USA) in accordance with the manufacturer’s instructions. The NMCM lysates were collected and incubated with magnetic beads conjugated with the mouse anti-HMGB1 antibody (RIP group), or rabbit IgG (IgG group) overnight at 4 °C. The resulting RNAs were collected to synthesize cDNA and analysed by qRT-PCR.

Adeno-associated virus construction and injection

To suppress cardiac AK144717 expression in vivo, adeno-associated virus, serotype 9 (AAV9) vectors carrying shAK144717 or GFP driven by c-Tnt (troponin T) promotor (AAV9-shAK144717 or AAV9-sh-Scramble) were purchased from Genechem Company (China). To compare the therapeutic effects of silencing AK144717 and DDR inhibition, C57BL/6 mice were randomly divided into 4 groups: TAC 6w (TAC), TAC + AAV9-sh-Scramble (TAC + Scramble), TAC + AAV9-sh-Scramble + KU55933 (TAC + Scramble + KU55933) and TAC + AAV9-shAK144717 (TAC + shAK144717) group (n = 6 per group). The titer of AAV9 given to mice was 3 × 1011 virus genome/mouse. AAV9-shAK144717 or AAV9-sh-Scramble were injected into C57BL/6 mice through caudal veins 1 week before TAC or sham surgery. KU55933 (5 mg/kg) was intraperitoneally injected three times per week after TAC surgery.

Microarray analysis

The ventricular samples from 3 mice operated by TAC for 6 weeks and 3 mice with sham surgery were sent to Shanghai KangChen Bio-tech Company to detect the differentially expressed lncRNAs by using Arraystar mouse lncRNA microarray V4. Unpaired, two-tailed Student’s t test was applied to check the differentially expressed lncRNAs between sham and TAC hearts. The differential expressed lncRNAs were identified with the fold-change > 2.0 and P < 0.05.

Statistical analysis

Data are expressed as mean ± SD (standard deviation). All data were analyzed by GraphPad Prism Version8 software (GraphPad Software, CA). Comparisons between two groups were analysed by unpaired, two-tailed Student’s t-test and between multiple groups were analysed by one-way ANOVA with Sidak’s or Tukey’s test. P < 0.05 was considered statistically significant (* indicate P < 0.05, ** indicate P < 0.01, *** indicate P < 0.001, and **** indicate P < 0.0001), whereas NS means not significant between groups.