Gathering patient data

Prognostic analysis of immune senescence-associated genes in EC was screened using TCGA database (https://cancergenome.nih.gov/), providing clinical data on 388 patients with EC and identifying genes differentially expressed in normal endometrial and cancerous tissues.

EC tissue specimens

Thirty patients with confirmed EC were collected through the medical records of the inpatient and outpatient departments of the First Hospital of Shanxi Medical University, and normal adjacent tissues of the same patients were used as the control group. Paraformaldehyde (4%) was used to fix the sample; sections were prepared and routinely dewaxed for immunohistochemical staining. The experimental protocol involving humans was approved by the Medical Ethics Committee of the First Hospital of Shanxi Medical University (KYLL-2024-118). Inclusion criteria for the study population: pathologically confirmed diagnosis of EC; no neoadjuvant radiotherapy or endocrine therapy prior to surgery; informed consent of the patients or their families. Exclusion criteria: previous or current comorbidity with other tumors; comorbidity with severe medical or surgical diseases, autoimmune diseases or other contraindications to surgery. Patient survival time: number of days of survival after surgery until 11 June 2024. Patients with postoperative recurrence confirmed by imaging and pathological examination.

The grouping of MYO3B low and high expression groups was based on the following: the staining intensity of cells was classified as none (0 points), low (1 point), medium (2 points), and high (3 points) by semi-quantitative method. The staining intensity and the proportion of tissue expression were 0–25% (1 point), 26–50% (2 points), 51–75% (3 points) and 76-100% (4 points), and the result of multiplying the two indexes was the final score. The expression of MYO3B was graded according to the scoring results: grade 0 (0–3 points), grade 1 (4–6 points), grade 2 (6–9 points), and grade 3 (9–12 points), with grades 0–1 classified as the low-expression group, and grades 2–3 classified as the high-expression group.

Cell experiments

Human endometrial epithelial cells (EECs, iCell, Shanghai), EC cells (KLE, AN3 CA, HEC-1-B, RL95-2, Ishikawa (IK), iCell, Shanghai) were routinely resuscitated and incubated in DMEM medium containing 10% fetal bovine serum and 100 mg/mL penicillin-streptomycin (Invitrogen, USA) at 37℃ in a 5% CO2 incubator, and then passaged until the cells reached 80% growth.

Set up cell grouping: (i) Control, sh-NC, sh-MYO3B-1, sh-MYO3B-2, sh-MYO3B-3, sh-MYO3B-4, sh-MYO3B-5, and sh-MYO3B-6; (ii) Control, pcDNA-NC, pcDNA-MYO3B; (iii) IK sh-NC, IK sh-MYO3B, KLE pcDNA-NC, KLE pcDNA-MYO3B; (iv) IK sh-NC, IK sh-MYO3B, IK sh-NC + Calmodulin agonist (CALP-2), IK sh-MYO3B + Calmodulin agonist (CALP-2), KLE pcDNA-NC, KLE pcDNA-MYO3B, KLE pcDNA-NC + Calmodulin antagonist (W-7), KLE pcDNA-MYO3B + antagonist (W-7); (v) IK sh-NC, IK sh-MYO3B, IK sh-NC + RhoA agonist (U-46619), IK sh-MYO3B + RhoA agonist (U-46619), KLE pcDNA-NC, KLE pcDNA-MYO3B, KLE pcDNA-NC + RhoA inhibitor (Y27632), KLE pcDNA-MYO3B + RhoA inhibitor (Y27632).

MYO3B knockdown (sh-MYO3B), overexpression (pcDNA-MYO3B), and corresponding negative controls (sh-NC, pcDNA-NC) were produced by GenePharma (Shanghai, China). According to the above grouping, the cells were transfected using Lipofectamine®2000 Transfection Reagent (Invitrogen, Shanghai, China). CALP-2 (57.9 µM, APExBIO, Shanghai, China), W-7 (28 µM, MCE, Shanghai, China), U-46,619 (0.1 µM, MCE, Shanghai, China), and Y27632 (10 µM, MCE, Shanghai, China) were added after cell apposition for 1 h after pretreatment. The cells in each group were cultured for 24 h.

Mouse EC transplantation tumor model

Male BALB/C-NUD mice (4–5 weeks old) were purchased from GemPharmatech Co., Ltd (SCXK (Chuan) 2020-0034) and housed in an SPF-grade environment. After 1 week of acclimatization, the mice were randomly divided into the shRNA-control group (sh-NC, n = 6), shRNA-MYO3B group (sh-MYO3B, n = 6). Ishikawa (IK) cells were transfected with a MYO3B silencing virus (sh-MYO3B; GenePharma) or a negative control (sh-NC; GenePharma). A disposable sterile insulin syringe was used to inject 100 µL of cell suspension into the right axilla of each mouse (1 × 107 cells/mouse); if the maximum diameter of the mass was found to be > 15 mm or the skin on the surface of the tumor was broken in the process of tumor growth, the mice had to be disarticulated and executed immediately (the diameter of the tumor mass could not exceed 15 mm and the volume could not exceed 1500 mm³), and the animals of all the groups on the 28th day of tumor formation, mice were executed by cervical dislocation, and the mice were photographed by peeling out the transplanted tumors. The study complied with the regulations of the Animal Control Committee of First Hospital of Shanxi Medical University (KYLL-2024-118).

Immunohistochemical staining

Endometrial cancer tissue and mouse tumor tissue Sect. (5 μm) were deparaffinized, antigenically repaired, endogenous peroxidase blocked with 3% hydrogen peroxide, serum blocked, and incubated overnight at 4℃ with the addition of primary antibody Ki-67 (1:400, HuaBio, Hangzhou, China), MYO3B (1:600, Affinity, Suzhou, China), ROCK1 (1:200, Abcam, UK), RhoA (1:100, ABclonal, Wuhan, China), and F-actin (1:200, GeneTex, Shanghai, China). Add secondary antibody (HRP labeled goat anti-rabbit, 1:100, Servicebio, Wuhan, China) and incubate at 37℃ for 30 min. DAB color development, hematoxylin re-staining, sealing, digital trinocular camera microcamera system (BA400Digital, Motic, Xiamen, China) for image acquisition, and Halo data analysis system (Indica labs, USA) was used to calculate the percentage of positive area (% DAB Positive Tissue) in each image.

CCK-8 assay

After the cells were incubated for 24 h, the medium was replaced with fresh medium, and 10 µL of CCK-8 reagent (Biosharp, Guangzhou, China) was added to each well. The plates were incubated in the dark, and cell survival was calculated based on the absorbance at 450 nm detected via a microplate reader (ELx800, BioTek, USA).

Flow cytometry assay

Cells were collected, centrifuged at 1000 r/min for 5 min, resuspended with 500 µL Binding Buffer, add 5 µL of Annexi V (KeyGEN, Nanjing, China), and add 5 µL of PI (KeyGEN, Nanjing, China), mix gently, and incubate for 15 min at room temperature under the condition of avoiding light, and then apoptosis was detected by Cytoflex flow cytometer (Beckman Coulter, USA) within 1 h. Ca2+ content analysis: Cell precipitates were obtained, cells were resuspended by adding 500 µL Fluo-4 AM (Beyotime, Beijing, China) dilution, incubated for 40 min at 37℃ away from light, and the supernatant was discarded by centrifugation at 1000 r/min. Subsequently, 500 µL PBS was added and washed twice, incubated at 37℃ for 20 min, centrifuged at 1000 r/min for 5 min, resuspended in 300 µL PBS, and analyzed by flow cytometry.

Scratch assay

When the cells were full grown to monolayer, the supernatant was aspirated, the pipette gun was scratched, the cells were washed twice with PBS, the scratched cells were removed, and the cells were cultured in 37℃ and 5% CO2 incubator according to the grouping. Samples were taken at the time points of 0 h and 24 h, and the scratched state of the cells was photographed with a microscope (DMI1, LEICA, Germany).

Transwell assay

Pre-chilled at 4℃ with 1:8 dilution of Matrigel (Corning, Suzhou, China) was added to the Transwell upper chamber, spread well, and dried at 37℃ for 70 min. Groups were prepared with cell suspensions, and the cell concentration was adjusted to 5 × 104 cells/mL, 200 µL of cell suspension was added to the upper chamber, and 600 µL of medium containing 20% FBS was added to the lower chamber as a chemotactic factor. The small chambers were incubated at 5% CO2 and 37℃ for 24 h. The cells in the upper chamber were wiped off with cotton swabs, rinsed with PBS, fixed with methanol, and stained with 0.1% crystal violet (Bomei, Hefei, China). Three fields of view of each well were selected and photographed under a light microscope, and the number of migrated cells in each group was counted.

Immunofluorescence staining

Cell crawls were washed 3 times with PBS, membrane-breaking solution (Servicebio, Wuhan, China) was added to cover the cells and incubated at room temperature for 10 min, bovine serum (Servicebio, Wuhan, China) was closed at room temperature for 20 min, and antibodies to F-actin (1:200, Abcam, UK) and Paxinllin (1:50, Abcam, UK) was incubated overnight at 4℃, and the antibody was added dropwise for 30 min at 37℃. Subsequently, DAPI (Servicebio, Wuhan, China) was added dropwise and incubated for 10 min at room temperature, and then sealed with anti- fluorescence quenching sealer. Images of the sections were captured using scanning and browsing software (OlyVIA, OLYMPUS, Japan), and the fluorescence intensity of all the captured images was measured using Image-J (National Institutes of Health, USA).

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from the cells using an ultra-pure RNA extraction kit (YEASEN, Shanghai, China), and 5 µL of RNA was taken to detect the integrity of RNA. The residual genomic DNA in the RNA was digested with a DNase I kit (Takara, Japan) and reverse transcription was performed using a reverse transcription kit (Takara, Japan). Amplification was performed using TB Green TM Premix Ex Taq™ II (Takara, Japan). The primer sequence: MYO3B, Forward sequences (5’-3’): TGAATCACTTCCAGATCCCACAG AC, Reverse sequences (5’-3’): CCAGGCTCCCATCTCTCTTGTTAG; GAPDH, Forward sequences (5’-3’): TGACTTCAACAGCGACACCCA, Reverse sequences (5’-3’): CACCCT GTTGCTGTAGCCAAA. GAPDH was used as an internal control. The relative expression of each target gene was quantified by the 2−ΔΔCt method; where ΔCt = Ct target gene – Ct internal reference and ΔΔCt = ΔCt experiment -ΔCt control.

Western blot analysis

RIPA cell lysis buffer was added to lyse the cells and tissue, which were subsequently centrifuged to collect the protein supernatant. SDS loading buffer was added, and the samples were boiled in boiling water. SDS-PAGE was used to separate proteins, which were transferred to PVDF membranes. Membranes were then blocked with 5% skim milk powder at room temperature. After incubation with primary antibodies at 4℃ overnight, including anti-MYO3B (1:2000), anti-RhoA (1:1000), anti-RhoB (1:2000), anti-RhoC (1:1000), anti-ROCK1 (1:1000), anti-LIMK (1:5000), anti-p-LIML (1:2000), anti-cofilin (1:1000), anti-p-cofilin (1:2000), and anti-β-actin (1:50000); Antibody from ABclonal (Wuhan, China), the membranes were washed with PBS three times, and incubated with goat anti-rabbit IgG (H + L) secondary antibody (1:5000; Affbiotech, Wuhan, China) for 1 h at room temperature. Developed by enhanced chemiluminescence (ECL, Zenbio, Shanghai, China), and the bands were exposed with Fluorescence Image Analysis System Software V2.0 (Tanon, Shanghai), and the results were scanned by Gel-Pro analyzer4 software and expressed as the integrated optical density (IOD) of the target protein.

Statistical analysis

Factors affecting recurrence in patients with EC (age, survival time, tumor size, metastasis, muscle layer, infiltration, histologic grade, and MYO3B expression) were analyzed using a logistic regression model with SPSS 20.0 software (IBM, USA). And the independent influencing factors affecting EC recurrence and MYO3B expression were also analyzed using binary logistic regression equations. Data were expressed as mean ± standard deviation (SD). Comparisons of data among groups were carried out by one-way ANOVA; the LSD test was used if the variance was homogeneous, and Tamhane’s T2 test was used if the variance was not homogeneous. A P-value < 0.05 was considered significant.