HD mouse models

Wild-type and R6/2 mice on a B6CBAF1/J background and zQ175DN mice on a C57BL6/J background were purchased from the Jackson Laboratory. Both males and females were included in the study. Genotyping of R6/2 (B6CBAF1/J) and zQ175DN (C57BL/6 J) mouse colonies (~ 150 CAG and 175 repeats, respectively) was performed by PCR of genomic DNA obtained from tail samples (Nucleo Spin Tissue, Macherey–Nagel, Cat. No. 740952.250) at weaning and following sacrifice for verification. CAG repeats of R6/2 and zQ175DN mice were sized as described in [18].

Generation of R6/2-A10cKO mice

R6/2 mice (B6CBAF1/J) were generated by crossing R6/2 males with wild-type females (B6CBAF1/J). The A10cKO colony was maintained by crossing heterozygous ADAM10 floxed mice (Adam10Flox/+) (C57BL/6 J × 129 S6) with CaMKIIalpha-Cre recombinase transgenic mice (C57BL/6 J × 129 S6). A10cKO mice exhibited a normal phenotype and normal fertility. From the crossing between heterozygous A10cKO and R6/2 mice, we tested 4 genotypes of the F1, including WT, R6/2, R6/2-A10cKO, and A10cKO, which are on the same mixed genetic background. Mice were genotyped as previously described in [18].

Treatment of mice with TAT peptides

Wild-type and R6/2 mice at 12 weeks of age received 2 i.p. injections 24 h apart of TAT-Pro-ADAM10709–729 (2 nmol/g) or TAT-Ala-ADAM10709–729 peptide (2 nmol/g) as described in [18]. Animals were euthanized 24 h after the second injection by cervical dislocation, and the brains were rapidly removed for dissection of the hippocampal tissues.

Primary mouse hippocampal neurons

The hippocampus was isolated from E18 mouse fetuses in ice-cold Hybernate™-E medium (Gibco™, Thermo Fisher Scientific, Cat. No. A1247601). The tissue was incubated for 15 min at 37 °C in pre-warmed dissociation buffer (PBS1X, papain 500 µg/mL, DNase I 2 U/mL, 5 mM glucose). Papain was then inactivated by adding PBS1X supplemented with 10% fetal bovine serum (FBS) (Euroclone,  Cat. No. EUS028597). After centrifugation for 3 min at 800 rpm, the solution was removed, and tissues were then mechanically dissociated in Neurobasal medium (Gibco™, Thermo Fisher Scientific, Cat. No. 21103049) supplemented with L-glutamine (GlutaMax from Gibco™, Cat. No. 35050061), N-2 supplement (Gibco™, Thermo Fisher Scientific, Cat. No. 17502048), B-27 supplement (Gibco™, Thermo Fisher Scientific, Cat. No. 17504044) and 10% FBS. Neurons were plated on poly-D-lysine-coated (Sigma-Aldrich, Cat. No. p6407-5MG) 12-mm glass coverslips (VWR, Cat. No. 631–1577) at a density of 1 × 105 cells/cm2. After 12–24 h from plating, FBS withdrawal was performed, and neurons were maintained in supplemented Neurobasal medium without FBS for up to 14 days in vitro (DIV14). Partial medium replacement was performed every 48 h. Treatment with the ADAM10 inhibitor GI254023X 1 µM (CliniSciences Cat. No.  HY-19956-5mg) was carried out from DIV6 until DIV14 during medium replacement. The TrkB blocker ANA12 (10 µM) (Tocris, Bio-Techne, Cat. No. 4781) was co-administered during medium replacement for 48 h before cell fixation at DIV14.

Preparation of total protein lysates and synaptosomes

Total protein lysates were prepared in RIPA buffer (50 mM Tris–HCl pH 8, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 1% Nonidet P40, 0.5% sodium deoxycholate) with 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 × protease inhibitor cocktail (Thermo Fisher Scientific, Cat. No. 1861281). Lysates were cleared by centrifugation for 30 min at 12,000 g and 4 °C. Synaptosomes were prepared by using Syn-PER Reagent (Thermo Fisher Scientific, Cat. No. 87793). Protein concentration was determined with the BCA assay (Thermo Fisher Scientific, Cat. No. 23225).

SDS-PAGE and Western Blot

20–60 μg of proteins were loaded on a 10% SDS-PAGE gel. Separated proteins were transferred onto a nitrocellulose membrane (Bio-Rad, Cat. No. 1704158) by means of the Trans-blot Turbo Transfer System (Bio-Rad) (High Molecular Weight protocol: 2.5 A constant; up to 25 V; 10 min), blocked with 5% nonfat milk (Bio-Rad, Cat. No. 1706404) in TBS1X and 0.1% Tween 20 (TBST) and incubated with rabbit polyclonal anti-ADAM10 antibody EPR5622 (1:1000 in TBST; Abcam, Cat. No. ab124695), mouse monoclonal anti-N-CAD antibody (1:1000 in TBST; Becton Dickinson Transduction Laboratories, Cat. No.610921), rabbit polyclonal anti-total-ERK1/2 antibody (1:2000 in TBST; Cell Signaling, Cat. No. 9102), rabbit polyclonal anti-phospho-ERK1/2 antibody (1:2000 in TBST; Cell Signaling, Cat. No. 9101), mouse monoclonal anti-βIII-Tubulin antibody (1:1000 in TBST; Promega, Cat. No. G7121), and mouse monoclonal anti-α-Tubulin antibody (1:5000 in TBST; Millipore, Cat. No. T9026) at 4 °C overnight. After washing, filters were incubated for 1 h at room temperature (RT) with a peroxidase conjugate secondary antibody (1:3000 in 5% nonfat milk; goat anti-rabbit HRP, Bio-Rad Cat. No. 1706515; goat anti-mouse HRP, Bio-Rad Cat. No. 1706516) and then washed 3 times with TBST. The Clarity Western ECL Substrate (Bio-Rad, Cat. No. 1705061) was used to visualize immunoreactive bands. Blot visualization was performed using the ChemiDoc MP Imaging System from Bio-Rad. Densitometric analyses were performed using Image Lab version 6.0.1.

Enzyme-linked immunosorbent assay (ELISA)

Due to a high degree of amino acid sequence homology between mouse and human BDNF, the Human BDNF ELISA Kit (Millipore, Cat. No. RAB0026) was used according to the manufacturer’s instructions. Before proceeding with the ELISA assay, synaptosomes underwent an acidification step, which is needed to allow BDNF release from vesicles. 50 µL of synaptosomes were diluted in 150 µL of PBS1X and then incubated with 4 μL of HCl 1N for 15 min at RT. 4 μL of NaOH 1N were then added to each sample to increase the pH of the solution from 4 to 7. All samples were assayed in duplicate, and the average value of each sample was normalized to the total protein concentration.

RNA preparation and retrotranscription

Total RNA was isolated from 50 to 100 mg of mouse brain tissue using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Thermo Fisher Scientific, Cat. No. 15596026). RNA concentration was evaluated using the NanoDrop® spectrophotometer, and its integrity was assessed by agarose gel electrophoresis. The DNA-free™ DNase Treatment and Removal Reagents (Invitrogen, Thermo Fisher Scientific, Cat. No. AM1906) were used to remove contaminating DNA from RNA preparations, and 500 ng of total RNA was reverse transcribed to single-stranded cDNA by using iScript™ cDNA Synthesis Kit (Bio-Rad, Cat. No. 1708891).

Real-time qPCR

Reactions were performed in a total volume of 15 μL containing 50 ng cDNA and SsoFast™ EVAGreen Supermix (Bio-Rad, Cat. No 1725204) following the manufacturer’s instructions. Quantitative RT-PCR was performed using a CFX96TM Real-Time System (Bio-Rad). The amplification consisted of the following steps: 95 °C for 3 min, 45 cycles of 30 s at 95 °C, 30 s at 60 °C, and 45 s at 72 °C. Fluorescence was quantified during the annealing step, and product formation was confirmed by melting curve analysis (55–94 °C). Data were analyzed with the CFX Manager software (Bio-Rad).

The following primer pairs (5’-3) were used:

Mouse Actin FW: AGTGTGACGTTGACATCCGTA

Mouse Actin RV: GCCAGAGCAGTAATCTCCTTCT

Mouse ADAM10 FW: GGAAGCTTTAGTCATGGGTCTG

Mouse ADAM10 RV: CTCCTTCCTCTACTCCAGTCAT

Mouse total BDNF FW: TCGTTCCTTTCGAGTTAGCC

Mouse total BDNF RV: TTGGTAAACGGCACAAAAC

Mouse BDNF Ex1 FW: ATCCACTGAGCAAAGCCGAAC

Mouse BDNF Ex2 FW: GTGGTGTAAGCCGCAAAGAAG

Mouse BDNF Ex3 FW: TCTGGCTTGGAGGGCTCCTG

Mouse BDNF Ex4 FW: CAGGAGTACATATCGGCCACCA

Mouse BDNF Ex5 FW: ACCATAACCCCGCACACTCTG

Mouse BDNF Ex6 FW: GGACCAGAAGCGTGACAACA

Mouse BDNF Ex7 FW: CTCTGTCCATCCAGCGCACC

Mouse BDNF Ex8 FW: GGTATGACTGTGCATCCCAGG

Mouse BDNF Ex9a FW: GCTTCCTTCCCACAGTTCCA

Mouse BDNF coding RV: CGCCTTCATGCAACCGAAGT (used for the amplification of BDNF mRNA isoforms).

Golgi staining

Wild-type, R6/2, R6/2-A10cKO and A10cKO mice at 13 weeks of age were anesthetized with 10 mg/mL 2,2,2-Tribromoethanol (Sigma-Aldrich, Cat. No. T48402) and transcardially perfused using 10/15 mL of saline solution (0.9% NaCl). After perfusion, dissected brains were quickly immersed in Golgi-Cox solution (potassium dichromate 1%, mercuric chloride 1%, and potassium chromate 0.8%) and processed as described in [21]. Stained neurons from the CA1 region of the hippocampus were acquired using a NanoZoomer S60 Digital slide scanner (Hamamatsu C13210-01). Stacks were collected every 0.5 μm with a 40 × objective and n = 3 mice/genotype were analyzed for a total of n = 30 neurons/genotype. The spine density of the proximal apical dendrite area was analyzed (minimum 100 μm from the soma). The second- or third-order dendrite (protruding from its parent apical dendrite) was chosen for spine density quantification. Z-stacks were made from each dendrite in the whole of the analyzed segment. The widths and lengths of dendritic spines were manually measured and categorized into thin spines (with length < 1 µm), stubby spines (with length to width ratios less than or equal to 1 µm), and mushroom spines (with widths > 0.6 μm) according to [22]. To determine the spine density, the software NDP View 2 (Hamamatsu) was used.

Transmission electron microscopy (TEM)

Sample preparation for TEM imaging was performed as described in [18]. Wild-type, R6/2, R6/2-A10cKO and A10cKO mice at 13 weeks of age (n = 3 mice/genotype) were anesthetized by intraperitoneal injection of 10 mg/mL  2,2,2-Tribromoethanol and transcardially perfused using 2.5% glutaraldehyde (Electron Microscopy Sciences, Cat. No. 16220), and 2% paraformaldehyde (Electron Microscopy Sciences, Cat. No. 19200) as fixatives, both in sodium cacodylate buffer 0.15 M (pH 7.4) (Electron Microscopy Sciences, Cat. No. 12300) and processed as described in [18]. For TEM imaging, ultrathin sections with a thickness of 70 nm were prepared using an UltraCut E Ultramicrotome (Reichert). These sections were then placed on TEM copper grids and imaged by a Tecnai G2 Spirit transmission electron microscope (FEI, Eindhoven, the Netherlands). The microscope operated at an acceleration voltage of 120 kV and was equipped with a lanthanum hexaboride thermionic source, a twin objective lens, and a bottom-mount 11MP Gatan Orius SC1000 CCD camera (Gatan, Pleasanton, USA). Quantitative measurements were performed by ImageJ, version 1.47 (NIH). The selection of the synapse and the analyses were performed by a blinded independent investigator in a genotype-blinded manner. We analyzed n = 3 mice/genotype and n = 60 synapses/genotype. The following parameters were measured: number SVs per μm2 presynaptic area, number of docked/reserve/resting vesicles per μm2 presynaptic area, and PSD length (nm). For SV distribution, the single vesicle has been manually annotated, and the distance to the active zone was expressed in nm. Docked vesicles were defined as vesicles within 50 nm of the active zone, reserve vesicles as vesicles between 50 and 300 nm from the active zone, and resting vesicles as vesicles beyond 300 nm of the active zone.

Immunocytochemistry for excitatory synapses analysis

Neurons were fixed in 4% paraformaldehyde for 15 min at RT. Cell membrane permeabilization and blocking of non-specific binding sites were performed in blocking buffer (PBS1X, 0.5% Triton X-100, 5% normal goat serum) for 1 h at RT. Primary antibodies were prepared in diluted blocking buffer (PBS1X, 0.25% Triton X-100, 2.5% normal goat serum) and incubated overnight at 4 °C. Neurons were rinsed three times in PBS1X for 10 min and incubated with secondary antibodies conjugated to Alexa fluorophores for 1 h at RT. Neurons were washed three times in PBS1X and then Hoechst 33258 (Molecular Probes, Invitrogen, Cat. No. H3569) was added for 10 min at RT. Neurons were washed three times in PBS1X and coverslips were mounted with Vectashield Vibrance Antifade Mounting Medium (Vector Labs, Cat. No. H-1700). Images were acquired with a confocal microscope Leica SP5 (LSCM, Leica Microsystems) with a 63 × objective (NA 1.40) or with IN Cell Analyzer 6000 with a 20 × or 40 × objective (GE Healthcare Life Sciences). The following primary antibodies were used: chicken polyclonal anti-Map2 antibody (Abcam, Cat. No. ab5392, 1:2000), mouse monoclonal anti-Bassoon antibody (Enzo Life Science, Cat. No. ADI-VAM-PS003-F, 1:500), rabbit polyclonal anti-Homer1 antibody (GeneTex, Cat. No. GTX103278, 1:500), rabbit polyclonal anti-GluA1 antibody (Millipore, Cat No. AB1504, 1:500). The following secondary antibodies were used: Alexa Fluor 647 goat anti-chicken IgY (Invitrogen, Cat. No. A32933, 1:500) Alexa Fluor 568 goat anti-mouse IgG (Invitrogen, Cat. No. A11004, 1:500), Alexa Fluor 647 goat anti-rabbit IgG (Invitrogen, Cat. No A27040, 1:500). Secondary antibodies were prepared in diluted blocking buffer. Dendrites were identified by Map2 staining. Since primary neuronal cultures can show a heterogeneous distribution, 3–7 fields were captured per well for each biological replicate. Acquired confocal field of images (FoV) were processed with the NIS-Elements software (V.5.30; Lim, Nikon INstruments). Twenty iterations of Richardson-lucy (a specific algorithm for point-scanning-confocal microscopy) deconvolution were applied. The number of synapses in each FoV was measured as Bassoon + /Homer1 + colocalizing puncta and was normalized on the total dendritic length. Since n = 3 biological replicates were performed, a total of 9–21 FoV were analyzed in any experimental condition. The number of synapses was calculated in 100-µm-long dendrites.

Analysis of dendritic spine density

Primary hippocampal neurons were transfected at DIV5 with pcDNA3.1-mGreenLantern plasmid (Addgene, Cat. No. 161912) and Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, Cat. No. L3000015) according to the manufacturer’s instructions. Lipofectamine was removed 1 h after transfection to avoid cytotoxic effects on primary neurons. After fixation with 4% paraformaldehyde neurons were subjected to immunostaining with an anti-GFP antibody (Abcam, ab13970, 1:500) and the presence of mGreenLantern + neurons was assessed by means of IN Cell Analyzer 6000. Dendritic spine analysis was performed manually with Fiji (ImageJ; https://imagej.net/software/fiji/downloads) in blind for genotypes and treatments. Spines were classified according to criteria described in [23]. Spines were judged thin if their length was greater than the neck diameter. Spines were judged mushroom if the diameter of the head was much greater than the diameter of the neck. Spines were judged stubby if the diameter of the neck was similar to the total length of the spine. Number of spines was calculated in 100-µm-long dendrites. For each experimental condition 4–5 dendrites were analyzed. Since n = 3 biological replicates were performed a total of 12–15 dendrites were analyzed in any experimental condition.

Induction of chemical LTP and electrophysiological recording

Whole-cell patch-clamp recordings were performed in voltage-clamp configuration at RT. Pipettes were prepared from borosilicate glass using a horizontal puller (P-97-Sutter Instruments) and, to isolate spontaneous excitatory postsynaptic currents (sEPSCs), they were filled with an intracellular solution containing 100 mM cesium methansulfonate, 25 mM CsCl, 2 mM MgCl2, 0.4 mM EGTA, 10 mM HEPES, 10 mM creatine phosphate, 0.4 mM Na-GTP (pH 7.4 with CsOH). The extracellular solution contained 125 mM NaCl, 1 mM MgCl2, 2 mM CaCl2, 2.5 mM KCl, 33 mM glucose, 5 mM HEPES, 0.02 mM bicuculline to block GABAA receptors (pH 7.3 with NaOH). Pipette series resistance was constantly monitored during experiments. Spontaneous post-synaptic currents were recorded using an Axopatch 200B amplifier (Axon Instruments) and digitized with a Digidata 1322A AD/DA converter (Axon Instruments). Signals were acquired using Clampex software (Molecular Devices), sampled at 20–50 kHz, and low-pass filtered at 10 kHz using Clampfit 10.2 (Molecular Devices). Chemical LTP (cLTP) was induced by replacing, for a period of 15 min at RT, the external solution with a Mg-free “cLTP inducing solution” containing 125 mM NaCl, 2 mM CaCl2, 2.5 mM KCl, 33 mM glucose, 5 mM HEPES, 0.2 mM glycine, and 0.02 mM bicuculline (pH 7.3 with NaOH). Recordings of sEPSCs were performed after switching back to the regular extracellular solution. Treatments with the ADAM10 inhibitor GI254023X 1 µM or with the combination of GI254023X 1 µM and the TrkB antagonist ANA12 10 µM were performed by adding them to the medium and to the conditioning and recording solutions.

Statistical analyses

Data are presented as means ± standard error of the mean (SEM) and were analyzed using GraphPad Prism Version 9.4.0 (453). For each data set we determined whether the data were normally distributed or not to select parametric or non-parametric statistical tests. Differences were considered statistically significant at P < 0.05. The specific statistical test used is indicated in the figure legends.