Antibodies and reagents

Anti-pYAP (S127) (#4911), anti-YAP (#14074), anti-pFAK (#8556), and FAK (#3285) were purchased from Cell Signaling Technology (MA, USA). β-actin (#A2228) was purchased from Sigma-Aldrich Inc. (MO). Anti-RBM39 (#SC-376531) was purchased from Santa Cruz (MO). Indisulam (#S9742) was purchased from Selleck Chemicals (TX, USA). LATS-IN-1 (#HY-138489) and E7820 (#HY-14571) was purchased from MedChemExpress (NJ). Cycloheximide and MG132 were purchased from FUJIFILM Wako Chemicals (Osaka, JP).

DNA constructs

Plasmid pRP-CMV-HA-RBM39 encoding human RBM39 was designed and purchased from Vector Builder (JP). GFP-expressing vector was used as control.

CRISPR/Cas9 genome editing

LATS1/2 KO cells were created using pLentiCRISPRv2 expressing CAS9 and sgRNA described previously [4].

Proteome analysis

One sample of 500 μg of protein from LATS1/2 KO CAL27 cells was used for co-immunoprecipitation analysis. For immunoprecipitation, cells were lysed in CHAPS buffer (1% CHAPS, 30 mM Tris-HCl, 150 mM NaCl) with protease and phosphatase inhibitor (#78444 Thermo Fisher Scientific, CO) and 1 mM DTT, incubated on ice for 15 min, and centrifuged at 16,000×g for 15 min at 4 °C. The supernatants were incubated with anti-YAP antibody (#14074 CST) for 24 h at 4 °C, then incubated with protein A agarose beads for 1 h at 4 °C. Beads were centrifuged and rinsed with CHAPS buffer 5 times. The beads were resuspended in 100 μL of 50 mM Tris-HCl pH8.0 and sent to the company (Promega, Madison, WI, USA). Peptide false discovery rate (FDR) < 1% and protein FDR < 1% are applied for the candidate proteins. The result was compared with BioGRID database (https://thebiogrid.org).

Cell culture and transfection

CAL27, HN12, and HN6 cells were kindly provided by J Silvio Gutkind, and their identifies were confirmed by STR profiling. They were also verified to be free of mycoplasma infection. CAL27, HN12, and HN6 cells were cultured in Dulbecco’s Modified Eagle Medium (D-6429, Sigma-Aldrich Inc., St. Louis, MO) supplemented with 10% Fetal Bovine Serum (Sigma-Aldrich Inc., St. Louis, MO), 1x antibiotic/antimycotic solution (Sigma-Aldrich Inc., MO) and 5 μg/mL plasmocinTM prophylactic (InvivoGen, CA).

Western blotting and immunoprecipitation

Western blotting and co-immunoprecipitation were performed as described previously [4]. Densitometry analysis of the bands was performed using “image J software”.

In situ proximity ligation assay

LATS1/2 KO CAL27 cells were seeded on the cover glass and cultured. After 24 h, cells were fixed in 4% paraformaldehyde in PBS for 10 min at room temperature. Cells were permeabilized using 0.5% Triton X-100 with 200 mM glycine for 10 min at room temperature. In situ PLA was performed with DuoLink In Situ Reagents (Sigma-Aldrich Inc, MO) according to the manufacturer’s instructions. We used the primary antibody against YAP and RBM39.

Cell viability assay

The cells were seeded in 96 well plates. The attached cells were treated with DMSO or indisulam for 3 days. CellTiter-Blue Cell Viability Assay reagent (Promega, Madison, WI, USA) was applied. The cells were then incubated with reagent for 4 h. The absorbance was measured using a microplate reader.

Crystal violet staining

The cells were seeded in 6 well plates. The attached cells were fixed with 4% formalin for 20 min, then stained with 0.5% crystal violet solution containing 20% methanol for 5 min.

RNA isolation and alternative splicing

RNA extraction was performed using the RNeasy Mini Kit following the manufacturer’s instructions (#74104, Qiagen, Hilden, Germany). The SuperScriptTM VILOTM cDNA Synthesis Kit (#11754250, Thermo Fisher Scientific, CO, USA) was used for cDNA synthesis. The following primers were used for alternative splicing. TRIM27 F: 5’ GCAGGTCCTGTTGGAGGTAA 3’, R: CCTGAACCTTGGATCACACC 3’ Total cDNA was amplified using Fast SYBR Green Master Mix (#4385612, Thermo Fisher Scientific, CO, USA).

Real-time PCR

RNA extraction and cDNA synthesis was performed as explained above. Real-time PCR and the primer sequences of CTGF/CYR61 were same as previously described [19]. The following primers were used for DCAF15. F: 5’ CCAGCCTGGCTATGTCAACT 3’, R: 5’ TCTTGTCGTCCTCCAACTCAT 3’.

RNA-seq

The cells were treated with DMSO or indisulam at 1 μM for 24 h (N = 3). RNA-seq samples were sequenced using the Illumina platform. For each sample, paired-end sequencing reads were mapped using HISAT2 version 2.1.0 to the hg38 reference human genome downloaded from Ensembl. To compute transcript abundance, uniquely mapped reads were quantified using featureCounts version 1.6.3. Differential gene expression analysis was performed using DESeq2 version 1.38.3, using a parametric fit. Metascape version 3.5.20230101 was used for Gene Ontology and KEGG pathway enrichment analysis [20]. MORPHEUS (https://software.broadinstitute.org/morpheus) was used to generate a heat map. The samples were sequenced using the Illumina platform for the splicing analysis. For each sample, paired-end sequencing reads were mapped using STAR version 2.1.0 to the hg38 reference human genome downloaded from Ensembl. RNA-Seq Multivariate Analysis of Transcript Splicing (rMATS) was used to detect alternative splicing events, where exon and intron regions were defined from the hg38 human reference genome. To estimate differential exon-skipping events, the number of exon-junction reads and exon-skipping reads were calculated and compared with DMSO-treated WT CAL27 cells. Alternatively, the numbers of exon-intron and exon-exon reads were used for differential intron retention. Read counts were evaluated using multiple Fisher’s exact tests in three two-by-two tables using R, and p-values were adjusted using the Bayesian posterior probability method and considered significant at p < 0.05.

In vivo mouse experiment

The tumor xenograft study was performed according to the protocol (#A22-29) approved by the Hiroshima University Research Facilities of Laboratory Animal Science. Female athymic nude mice (BALB/cAJcl-nu/nu, 5 to 6 weeks old) were purchased from CLEA Japan (Shizuoka, Japan). WT and LATS1/2 KO CAL27 cells were transplanted into both flanks (2 million cells per tumor) of each mouse. When the average tumor volume reached a predetermined value (~150 mm3) the mice were randomized into groups (10 tumors per group). Indisulam (Selleck Chemicals, 25 mg/kg/day) or the control diluent (3.5% DMSO, 6.5% Tween 80, 90% saline) was injected into the mice intraperitoneally. The mice were euthanized at the indicated time points (or when control-treated mice succumbed to the disease, as determined by the protocol).

Statistical analysis

GraphPad Prism version 9 for Windows (GraphPad Software, CA) was used for statistical analysis. The data were analyzed by student’s t-test (two-sided) and analysis of variance (ANOVA) with Tukey–Kramer post hoc test. All experiments were repeated independently three times with similar results. All samples showed equal SE.