Clinical breast cancer specimens and IHC

Between December 2018 and December 2021, 24 breast cancer patients from Tongji Hospital, Huazhong University of Science and Technology underwent 18F-FDG PET/CT scans, and tumor biopsies were retrospectively collected and analyzed. The maximum standard uptake value (SUVmax) of the primary tumor was obtained from a PET/CT scan and analyzed at the Department of Radiology, Tongji Hospital. Paraffin sections of primary tumors were also obtained from these patients through surgical resection or biopsy, and IHC staining was performed using the DAB2IP antibody (Abcam, Cat. #ab87811), as previously described [16].

The IHC results were analyzed under a microscope at 200x magnification. For each specimen, five visual fields were randomly selected and scored by summing the proportions and staining scores. The proportion score reflected the fraction of positively stained cells (0, none; 1, ≤ 25%; 2, 25% to 50%; 3, 50% to 75%; 4, > 75%), and the staining score revealed staining intensity (0, no staining; 1, weak; 2, intermediate; 3, strong). DAB2IP IHC intensity was calculated as the sum of the proportion and staining scores. The final DAB2IP IHC intensity score was the average score of five visual fields.

Cell lines, culture, and hypoxia induction

Breast cancer cell lines MCF7, T47D, ZR-75-1, MDA-MD-231, MDA-MD-468, HCC1937, and human embryonic kidney cell line HEK293T were purchased from and authenticated by the American Type Culture Collection (Manassas, VA, US). Cells were cultured at 37 °C in a 5% CO2 incubator. The MCF7 and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (KeyGEN, Cat. #KGM12800N). T47D, ZR-75-1, and HCC1937 cells were cultured in RPMI-1640 medium (1640) (KeyGEN, Cat. #KGM31800N). The MDA-MB-231 and MDA-MB-468 cells were cultured in Leibovitz L-15 medium (L15) (KeyGEN, Cat. #KGM41300N). All culture media were supplemented with 10% fetal bovine serum (Cat. #086-150) and 1% penicillin/streptomycin (Cat. #KGY0023). Mycoplasma contamination was test by Mycoplasma PCR Detection Kit (Beyotime, Cat. #C0301S) according to the manufacturer’s instruction. To stimulate hypoxic condition, cells were cultured in anaerobic incubator (5% CO2, 1% O2) at 37 °C for 12 h before further experiments were conducted.

Small interfering RNA, plasmid, and site-directed mutagenesis

Small interfering RNAs (siRNAs) were purchased from Tsingke Biotechnology Co., Ltd. (Beijing, China). pcDNA3.1-Flag-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP-C-terminal, and pcDNA3.1-Myc-tagged-DAB2IP-N-terminal overexpressing plasmids were obtained as previously described [16]. HIF-1α and STUB1 overexpressing plasmids were purchased from TsingkeBiotechnolog Co., Ltd. (Beijing, China). Truncated and site-directed mutagenesis of DAB2IP plasmids was performed using the Mut Express II Fast Mutagenesis Kit V2 (Vazyme, Cat. # C214-01) according to the manufacturer’s protocol. The siRNAs sequences and primers used for plasmid mutagenesis are listed in S. Table 1.

CRISPR/Cas9

DAB2IP was knocked out using the CRISPR/Cas technique. Briefly, sgRNAs targeting DAB2IP were designed using the website software E-CRISP (http://www.e-crisp.org/E-CRISP/) (target sequence: 5‘–3‘ GGAGGTCCTCCTACTACTAC). Then, the sgRNA was synthesized and packaged into a CRISPR/Cas9 lentivirus (performed by Shanghai Genechem Co., Ltd). After infection, the cells were treated with 2 μg/mL puromycin for 1 week. The remaining cells were trypsinized and seeded into 96-well plates to obtain single-cell clones. After single-cell expansion, western blotting was performed to identify the DAB2IP-KO clones.

Transfection and stable cell line establishment

Transient transfection of small interfering RNA (siRNA) and plasmids were performed using Lipofectamine 3000 (Thermo Fisher, Cat. #L3000015) according to the manufacturer’s protocol. Biological and biochemical experiments were performed 48 h after transfection.

Recombinant lentiviruses expressing sh-scramble and sh-DAB2IP (previously obtained in [16]) were used to establish stable DAB2IP knockdown (DAB2IP-KD) cell lines. Stable DAB2IP overexpressing lentivirus was established using pLVX (backbone) - psPAX2/pMD2. G (packaging vector). The DAB2IP gene from the pcDNA3.1-DAB2IP plasmid was cloned into the pLVX vector, and the virus particles were packaged using HEK293T. At 48 h after lentivirus infection, cells were treated with 2 μg/mL puromycin until all cells in blank group had died. Western blotting was used to validate the DAB2IP protein levels in stable cell lines.

Cell viability examination

Briefly, 5000 cells per well were seeded in 96-well plate and treated with CoCl2 at a concentration of 150 μM to induce hypoxia. Then the cells were cultured at 37 °C in a 5% CO2 incubator for 3 days. The cell viability was examined at 24, 48, and 72 h. During each examination, medium was replaced and added 10 μL Cell Counting Kit-8 (CCK8) solution (MCE, Cat. #: HY-K0301). After 120 min of incubation at 37 °C, 450 nm optical density (OD) was detected via spectrometer.

Glucose uptake assay

The glucose uptake assay was performed using a Glucose Uptake Assay Kit (Promega, Cat. #: J1341). Briefly, 2-Deoxy-D-glucose (2-DG) was added to the culture medium. After 10 min incubation at 37 °C, the 25 μL reaction stop solution, 25 μL neutralization buffer, and 100 μL 2-Deoxy-D-glucose 6-phosphate (2-DG-6P) solution provided by the kit were sequentially added into the medium according to the manufacturer’s instruction. Then, the luminescence signal was detected and recorded using a GloMax® 20/20 Luminometer. Three bio-replications were performed for each experiment.

Intracellular adenosine triphosphate (ATP) examination

The intracellular ATP levels were measured using an ATP detection kit (Beyotime, Cat. #S0026). Briefly, 2 × 106 cells were collected and lysed in 200 μL ATP detection lysis buffer 4 °C for 10 min. Then cell lysate was centrifuged at 4 °C, 12000 g for 5 min, and the supernatant was collected. Working solutions and standards were prepared according to the manufacturer’s instructions. The detection working solution was mixed with the supernatants or standards at 4 °C for 5 min, and the luminescence intensity was measured by GloMax® 20/20 Luminometer. Three bio-replications were performed for each experiment.

Lactate production examination

The culture medium was collected and centrifuged at 14,000 g at 4 °C for 5 min. Then, the lactate level in each supernatant was measured with a lactate content detection kit (Nanjing Jian-Cheng Biotech Co., Ltd, Cat. #A019-2-1) using a multimode plate reader according to the manufacturer’s instructions.

Seahorse ECAR examination

A Seahorse XF Pro analyzer (Agilent, US) was used to detect ECAR. Briefly, 5 × 105 cells per well were seeded into an XF24 plate, and the XF flux sensor was hydrated without CO2 overnight according to the manufacturer’s protocol. On the day of the experiment, the sensor cartridge of the instrument was pre-warmed at 37 °C for 5 h. The sample culture medium was replaced by with analytical buffer, and the XF24 plate was incubated without CO2 at 37 °C for 60 min. The XF24 plate was then placed into the instrument, and the measurement was started. Glucose, oligomycin, and 2-DG were obtained from a Glycolysis Stress Test Kit (Agilent, Cat. #:103020) were sequentially added to the sample at appropriate concentrations, according to the manufacturer’s instructions. ECAR values were recorded and analyzed using the GraphPad Prism software. Each experiment was performed in triplicate.

Western blot and co-immunoprecipitation (Co-IP) assay

Western blotting and co-IP assays were performed as previously described [16]. The antibodies used in the experiments are listed in S. Table 2.

Ubiquitination assay

The ubiquitination assay was performed as previously described [16]. Briefly, cells transfected with HA-tagged-ubiquitin plasmid were treated with MG-132 at a dose of 10 μM for 8 h. Then cells were lysed in NP40 buffer and centrifuged at 12000 g at 4 °C for 15 min. Cell lysates were immunoprecipitated with the agarose beads which were incubated with indicated primary antibody overnight at 4 °C. Target protein ubiquitination was examined by western blot using an anti-HA antibody.

PLA

Cells were fixed with 4% paraformaldehyde at 25 °C for 20 min and were permeabilized with 0.1% Triton-X100 for 10 min. Nonspecific staining was blocked by incubation in goat serum for 1 h. Subsequently, cells were incubated with the primary antibody STUB1 (C3B6, CST Cat# 2080, RRID: AB_2198052) at 1:100 dilution at 4 °C overnight. After washing, hybridization, ligation, amplification and staining were performed by PLA detection kit (Duolink® PLA Control Kit – PPI, Sigma Aldrich, Cat. # DUO92202) according to the manufacturer’s protocol. Images were captured using a fluorescence microscope (OLYMPUS IX71) at 400 magnification. The PLA was visualized using a green signal.

Mass spectrum analysis

Mass spectral analysis was performed by Shanghai Lu-Ming Biotech Co., Ltd., as previously described [16]. Mass spectra were analyzed using Proteome Discoverer 2.3 search engine (Thermo Scientific, MA, US), and Uniprot-Homo database using the Sequest algorithm [44].

Animal study

All animal experiments were approved by the Ethics Committee of Tongji Hospital. Female BABL/c nude mice (age 4 weeks) were purchased from Shulaibao (Wuhan) Biotechnology Co., Ltd. The mice were randomly divided into two groups without blinding and subcutaneously injected 1 × 106 tumor cells in Matrigel (Corning), with six mice per group. After 30–36 days, the mice were euthanized, and the tumors were removed, embedded, sliced, and stained with hematoxylin and eosin (HE). The expression of DAB2IP was evaluated using immunohistochemistry.

A micro-PET/CT scan was performed by skilled technicians in the Nuclear Medicine Department of Wuhan Union Hospital. Briefly, the female BABL/c nude mice were randomly divided into two groups without blinding (n = 3 per group) and subcutaneously injected 1 × 106 tumor cells in Matrigel (Corning). After 4 weeks, the mice were fasted for 8 h before scanning. After weighting, 100 μL of 1.85 MBq 18F-FDG/PBS solution was injected into the mice via caudal vein at 1 h before experiment. Mice were anesthetized with 5% isoflurane and placed on a scanning bed. During scanning, an airflow of 1% isoflurane was used to maintain anesthesia. The CT and PET scan images were reconstructed using uBio-EXPLORER software through the Order Subset Expectation Maximization (OSEM) algorithm (four OSEM iterations with 1.4 mmHD resolution) and CT attenuation correction. The SUVmax of the xenografted tumors was also measured and analyzed.

Bioinformatics and statistical analysis

Gene expression profile and prognosis data of patients with breast cancer was obtained from The Cancer Genome Atlas – breast invasive carcinoma (TCGA-BRCA) database (http://portal.gdc.cancer.gov) and analyzed via GEPIA software (http://gepia.cancer-pku.cn/index.html) [45] and R2: Genomics Analysis and Visualization Platform (http://hgserver1.amc.nl/cgi-bin/r2/main.cgi). Potential protein interactions were analyzed using the STRING database (https://www.string-db.org/).

All continuous data were reported as the mean ± SD and analyzed via Two-tailed Student’s t-test or analysis of variance (ANOVA). Categorical variables were compared using the χ2 test or Fisher test. P < 0.05 was considered statistically significant. Statistical analysis was performed using the software package SPSS (version 19.0 for Windows; IBM, USA) and GraphPad Prism (version 9.41 for Mac; GraphPad Software, Inc., USA).