Cell culture

Hepa 1–6 (Murine hepatoma cell line) was acquired from National Centre for Cell Sciences (NCCS) Pune, India. DMEM high glucose media containing 10% v/v FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin while maintaining a humidified environment with 5% CO2 at 37 °C was utilized for growing these cells. Insulin resistance was induced as described previously [26]. Palmitate dissolved in ethanol was added to a 20 percent FFA-free BSA (sigma) solution warmed to 37 °C. This mixture was further subjected to dilution with plain medium to a final concentration of 5 percent BSA, 1 percent ethanol and 250uM palmitate. Before adding onto the cells, the palmitate solution was cleared by heating it at 37 °C and then filter sterilised. As a control for palmitate, 5 percent BSA and 1 percent ethanol were used. Palmitate was prepared fresh for each experiment.

Mimic/inhibitor transfection

For transfection of miR-721 mimic (Qiagen, Cat. No. 219600), inhibitor (Qiagen, Cat. No. 339121) and their respective controls (Qiagen negative control mimic Cat. No. 339173, inhibitor control Cat. No. 339121), Lipofectamine 3000 (Invitrogen, CA, USA) was utilized following the instructions provided in the kit. In brief, For 24 h, Hepa 1–6 cells were cultured in 12-well or 6-well plates in antibiotic free medium. In a serum-free OptiMEM medium, 50 nM of miR-721 mimic, scramble mimic, or miR-721 inhibitor, scramble inhibitor, and Lipofectamine 3000 reagent was added independently for each well. These above mentioned components were subjected to room temperature for 5 min followed by mixing and incubation for 20 min. The resulting transfection mix was subsequently added to cells in complete growth medium and left to incubate for 24 h. On completion of incubation, the media was removed, followed by subsequent washing with PBS. Fresh media was added and the cells were used for further experiments.

Insilico prediction of miR-721 targets

Multiple target prediction software tools were utilized in this study to identify the potential targets of miR-721. These tools included miRDB (http://mirdb.org), TargetScan (http://www.targetscan.org), miRWalk (http://mirwalk.umm.uni-heidelberg.de), miRmap (http://mirmap.ezlab.org), and StarMir (http://www.starmirdb.org). Each software employs distinct algorithms and databases to predict miRNA-target interactions based on sequence complementarity, evolutionary conservation, and other relevant features. Consensus predictions from these multiple tools were further analyzed and KDM2A was selected as a potential target gene for experimental validation.

Invitro glucose production

Invitro glucose production was estimated as per the previously reported protocol [27]. The cells subcultured into 12-well plates were subjected to different treatments. Before the termination of incubation, the media was changed to glucose-free DMEM supplemented with 20 mM lactate (Sigma) and 2 mM pyruvate (SRL chemicals, India), and the cells were incubated in this medium for 4 h. After 4 h, the glucose concentration in the medium was assessed using a glucose assay kit (Sigma). The glucose levels were adjusted relative to total protein content.

Animal study

Four to six weeks old male C57BL/6 J mice, procured from the Small Animal Facility for Experimentation (SAFE), IISER, India, were housed in Central Animal Facility (CAF), NIPER, India. The mice were accommodated in a controlled environment with a temperature of 22 ± 2℃, humidity at 50 ± 10%, and a 12-h light/dark cycle. They were provided unrestricted access to food and water. Each cage housed 4–6 animals, and acclimatization was conducted a week prior to the commencement of the experiment. The Institutional Animal Ethics Committee of NIPER provided approval for the study protocol (IAEC/21/09-ext1).

In total, 24 animals were divide into 2 groups, the first group consisted of six animals and the remaining 18 animals constituted the second group. The first group was fed a standard pellet diet (C 0400, Altromin, Germany) whereas the second group was fed with high fat diet (D14292, Research Diets, USA) for 12 weeks. On completion of 12 weeks, the development of insulin resistance was confirmed by determining fasting plasma glucose, cholesterol triglycerides, and performing IPGTT (intraperitoneal glucose tolerance test), ITT (insulin tolerance test) and PTT (pyruvate tolerance test). Afterwards, the HFD fed group was further divide into 3 groups of 6 animals each- HFD + SI (Scramble inhibitor), HFD + MI (miR-721 inhibitor) and HFD + LA200 (Laccaic acid) groups. The scramble and miR-721 inhibitors were administered intravenously via tail vein, twice weekly for 2 weeks at 5 nmol/dose/animal and laccaic acid (Catalog #L0095, TCI chemicals, India) was administered orally at a dose of 200 mg/kg/day for 4 weeks, suspended in 0.1% CMC.

Biochemical parameters

Blood was collected from the retro-orbital plexus of the mice and transferred to EDTA-containing microcentrifuge tubes. The biochemical parameters were then evaluated using the plasma separated by centrifugation of the collected blood at 7000 rpm for 10 min at 4 °C. Plasma glucose, triglycerides, and total cholesterol were measured using commercially available kits from Accurex Biomedical Pvt. Ltd in Mumbai, India, in accordance with the manufacturer's instructions.

Intraperitoneal glucose tolerance test (IPGTT), Insulin tolerance test (ITT) and Pyruvate tolerance test (PTT)

To evaluate glucose uptake capability, insulin sensitivity and glucose production, Intraperitoneal Glucose Tolerance Tests (IPGTT), Insulin Tolerance Tests (ITT), and Pyruvate Tolerance Tests (PTT) were performed following previously described protocols [28]. The animals were fasted for 12 h before IPGTT and PTT and 4 h before ITT. Subsequent to fasting, a glucose load of 2 g/kg; i.p, sodium pyruvate 2 g/kg; i.p or insulin (Humulin-R, Eli Lilly) 0.75 IU/kg; i.p, in IPGTT, PTT, and ITT, respectively. An Accu-Chek Active glucometer measured blood glucose levels at 0, 15, 30, 60, and 120 min after administering glucose, pyruvate, or insulin. The tail snip method was utilized for blood sampling. Area under the curve was determined using the changes in plasma glucose concentrations over time plot via GraphPad Prism 8 software.

Histopathology

Histopathological assessment was conducted following earlier reported procedures [11]. Briefly, the animals were euthanized and liver was dissected and fixed using 10% neutral buffered formalin, gradually dehydrated using ethanol, cleared using xylene, and finally embedded in paraffin. Afterwards, 5 μm sections were taken and air dried overnight. Deparaffinization of sections with xylene followed by rehydration with a combination of alcohol and water were stained using Haematoxylin and Eosin (H&E) and Periodic-acid Schiff (PAS). Finally, the sections were mounted using DPX mounting media and microscopic examination was carried out using an Olympus BX51 microscope (Tokyo, Japan).

For oil red O staining, frozen tissues were embedded in the OCT (optimal cutting temperature compound, Sigma) embedding medium and 5um sections were cut using cryotome (Leica CM 1860, Leica Biosystem). The sections were air dried for 1 h, fixed with neutral buffered formalin. After staining with oil red O for 20 min, the sections were counterstained with hematoxylin and mounted using glycerol gelatin mountant and examined under microscope (OLYMPUS BX51, Tokyo, Japan).

Immunohistochemical evaluation

Immunohistochemical studies were performed in accordance with the instructions provided with the kit (ImmPRESS® Excel Amplified polymer staining kit, Antirabbit IgG, Cat# MP-7601–15, Vector Laboratories, CA, USA). Primary antibodies against KDM2A (A18636, ABclonal Technology, MA USA) and FOXO1 (A2934, ABclonal Technology, MA USA) were used. Following counterstaining with hematoxylin, the sections were mounted with DPX and observed using a microscope (OLYMPUS BX51, Tokyo, Japan). Subsequently, the images were quantified utilizing ImageJ software (NIH, MD, USA).

RNA isolation and qRT-PCR

Liver tissue was processed to extract total RNA employing the Trizol method. Subsequently, cDNA was synthesised utilizing the Verso cDNA synthesis kit (AB1453A-Thermo Scientific) in accordance with the kit instruction manual. NanoDrop 1000 (ThermoFisher Scientific). was used to analyze the quality of the extracted RNA. Kdm2a, Foxo1, G6pc, and Pck1 expression levels were analyzed employing qRT-PCR using Brilliant III SYBR Master Mix (Agilent, Santa Clara, USA) along with gene-specific primer sequences (Eurofins India Pvt Ltd). Each gene's primer sequences are provided in Table 1. Using specific primers, actin levels were also amplified and used for normalization. 2-ΔΔCt method was used to analyze the amplification curves.

Table 1 List of primers used in qRT-PCR

MiRNA was extracted from Hepa 1–6 and liver tissues employing the HiPure miRNA isolation kit (Catalog #05080576001, Roche, Basel, Switzerland), and its purity was assessed using the NanoDrop 1000 spectrophotometer. The miRCURY LNA RT Kit (Catalog #339340, Qiagen, USA) and Thermal Cycler 2720 (Applied Biosystems, CA, USA) were used for cDNA synthesis. Real-time PCR analysis was conducted on an AriaMx instrument (Agilent Technologies, Inc, CA, USA) employing pre-made primer mix specific for mmu-miR-721 (Catalog #339306, Qiagen). The levels of miRNA expression were normalized against U6 small nuclear RNA (Catalog #203907). Amplification curves were analyzed using the 2-ΔΔCt method, and the resulting relative values were plotted.

Immunoblotting

Immunoblot analyses were conducted following established procedures [10]. In brief, Hepa 1–6 cells or liver tissues underwent lysis using NP-40 lysis buffer, and the resulting protein samples were separated on 8–14% SDS-PAGE gel electrophoresis. Transblot SD Semi-Dry Transfer Cell (Bio-Rad Laboratories) was used to transfer proteins onto Polyvinylidene difluoride (PVDF) membranes which were then subjected to incubation with primary antibodies (diluted at 1:1000): KDM2A (A18636, ABclonal Technology, MA USA), FOXO1 (A2934, ABclonal Technology, MA USA), PCK1 (A22172, ABclonal Technology, MA USA), G6PC (A20193, ABclonal Technology, MA USA), and Actin (sc-47778, Santa Cruz Biotechnology, USA). Following an overnight incubation at 4℃, subsequent incubation of membranes was done with secondary antibodies conjugated with horseradish peroxidase (HRP) (Jackson Immunoresearch, USA) for 1 h at room temperature. The resulting immune complexes were detected and visualized using an enhanced chemiluminescence substrate (Invitrogen, CA, USA) and images were captured using Image Quant 500 (Amersham). Densitometric analysis of the immunoblot images was performed using ImageJ software, NIH, USA.

Chromatin immunoprecipitation

The Chromatin Extraction kit’s (Abcam, USA, Cat. # ab117152) was used to extract chromatin from Hepa 1–6 cells and liver tissues, and ChIP-qPCR was conducted using a one-step ChIP kit (Abcam, USA, Cat.# ab117138) following the manufacturer's instructions. In summary, Hepa 1–6 cells were treated with neutral buffered formalin for cross-linking. Following cross-linking, the cells were homogenised using the lysis buffer supplied with the kit. The liver samples were minced on ice before crosslinking and proceeding further. The resulting homogenate was centrifuged, yielding a nuclear pellet, which was resuspended in chromatin extraction buffer for isolating chromatin. The fragmentation of isolated chromatin was done using BioRuptor (Diagenode) set at sonication for 10 cycles, with each cycle comprising 10 s followed by 15-s intervals. A portion (10%) of the fragmented chromatin was retained as an input control, while the rest was incubated overnight at 4℃ with the anti-H3K36me2 antibody for immunoprecipitation. Afterwards the antibody-protein-DNA complexes were washed to remove any unbound antibodies. Subsequently, the cross-linking between the proteins and DNA was reversed by treating the complexes with the DNA release buffer. The DNA thus obtained was subjected to real-time PCR analysis. Additionally, DNA from the input samples was extracted and used for normalisation. Specifically designed primers for the FOXO1 promoter region (forward: 5′—AAGTGAGATTCCCGTGGCAG -3′, reverse: 5′—GTAACCGCTTCCCACCCTAC -3') were employed to quantify the abundance of H3K36me2.

Statistical analysis

The experimental results are presented as the mean values with standard deviations (mean ± SD). Two-tailed Student's t-test was applied to compare means of two groups. In cases where multiple groups were compared, one-way analysis of variance (ANOVA) was used and Tukey's test was employed for post-hoc analysis. A significance threshold of p < 0.05 was considered as statistically significant.