Animals

Healthy male Wistar rats weighing 200 ± 20 g were purchased from SiPeiFu Biotechnology Co., Ltd (Beijing, China), and fed a normal chow diet (NCD) or HFD (60% ratio of fat to energy supply) (Keao Xieli Feed Co., Ltd, Beijing, China) for 20 consecutive weeks. Each rat was housed in settings of 22 − 24 °C, 12 h of light and darkness, and unrestricted access to clean water. The body weight of the rats was recorded once every 4 weeks. All experimental protocols were approved by the Institutional Animal Care and Use Committee of the China Medical University (CMU2021492) and followed the guidelines provided by the National Institutes of Health (NIH, USA).

Blood biochemistry analysis

After 20 weeks of feeding, blood samples were collected from the rat’s tail vein after a fast of 6 h. The fasting and OGTT Glucose Tolerance Test glucose levels were detected using a blood glucose meter and glucose test strips (OneTouch Ultra Easy, China). Serum insulin content was measured using the competitive rat insulin enzyme-linked immunosorbent assay (ELISA) Kit (EK3220-96, MULTI SCIENCES, China) following the manufacturer’s instructions. The triglyceride (TG), cholesterol (CHO) and low-density lipoprotein (LDL-C) indexes were analyzed using an automatic biochemical analyzer (Chemray800, Rayto, China).

Echocardiography

In the 20th week, transthoracic echocardiography was performed using a Vevo 3100LT system with an MX250 probe (center frequency 30 MHz). Briefly, isoflurane was used to anesthetize rats (5% for inducing and 2% for maintaining anesthesia). The rat’s paws were taped to a conductive paste-coated electrode to maintain the correct electrocardiogram (ECG), body temperature, and respiratory rate. The chest wall was exposed after depilation. Images were recorded along the short axis in the middle part of the left ventricle and stored offline for subsequent analysis (VevoLAB3.2.6). The cardiac function parameters obtained are listed in Table S1A.

Histological analysis

Myocardial tissues were fixed in 4% paraformaldehyde overnight, then they were prepared into 6-µm-thick paraffin sections. To assess the histological change of the myofibers, the sections were stained with hematoxylin and eosin. Special staining (Masson and Sirius red staining) was performed to determine the collagen deposition.

Circ RNA microarray

Total RNA was extracted from each myocardial sample using TRIzol Reagent (15596-026, Invitrogen, USA) and quantified using NanoDrop ND-1000 (Thermo Fisher, Waltham, MA, USA). For sample preparation and microarray hybridization, the standard Arraystar techniques were used. In short, RNase R (Epicenter, Inc.) was used to digest total RNAs, separate linear RNAs, and enrich circular RNAs. The enriched circular RNAs were then amplified and converted into fluorescent cRNA utilizing a random priming method (Arraystar Super RNA Labeling Kit; Arraystar). The Arraystar Rat circRNA Array (8 × 15 K, Arraystar) was hybridized with the tagged cRNAs. After the slides were washed, the Agilent Scanner G2505C was used to scan the arrays.

Meanwhile, the Agilent Feature Extraction (version 11.0.1.1) software was employed to examine the images obtained in the array. Quantile normalization and subsequent data processing were performed using the R software limma package. Meanwhile, volcano plot filtering was used to identify differentially expressed circRNAs between two statistically significant groups. With fold-change filtering, circRNAs that were differentially expressed between two samples were identified. Hierarchical clustering analysis was performed to display the unique circRNA expression pattern across samples.

Quantitative real-time polymerase chain reaction

To detect the mRNA level, an aliquot of 800 ng of total RNA was reverse transcribed using the PrimeScriptTM RT reagent Kit with gDNA Eraser (RR047A, TaKaRa, Japan). The cDNA sample was subjected to quantitative real-time polymerase chain reaction (qRT-PCR) using TB Green® Premix Ex Taq TM II(Tli RHaseH Plus)(RR820A, TaKaRa, Japan) and the QuantStudio TM II Real-Time PCR Instrument (A40425,Thermo Fisher Scientific, USA). Gene expression levels were normalized using β-actin. To measure miRNA expression, miRNA was converted into cDNA using the Mir-XTM miRNA First-Stand Synthesis Kit (638,313, TaKaRa, Japan), followed by amplification by qRT-PCR using TB Green® Premix Ex Taq TM II. U6 was used as an intern control for normalization. Moreover, gene expression was analyzed using the 2−ΔΔCt method. The primer sequences used was listed in Table S1E.

RNA in situ hybridization (ISH)

To detect the expression pattern of circ_005077 in myocardial tissue, RNA ISH using an ISH kit (Boster Biological, CA, USA) was performed. Appropriate amounts of pepsin was added to paraffin sections and digested at 37 °C for 15 min to expose the nucleic acid fragment. The digoxigenin-labeled circ_005077 probe(5‘-CTGTTGTGGTGCCGGTCTCTCTTTGTCCTGCTCTTGCTCC-3’) was hybridized with the tissue after prehybridization. The biotinylated rat antidigoxigenin, the streptavidin–biotin complex (sABC), and the biotinylated peroxidase were then added. Finally, the color develops with DAB for 3 min. Slices were blocked and observed under a microscope (Aperio Versa 8, Leica, Germany).

Cell culture and PA treatment

The adult rat cardiomyocyte line (H9c2) obtained from the Chinese Academy of Sciences (Shanghai, China) was cultured in low glucose medium containing 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 µg/ml streptomycin in a 37 °C, 5% CO2 incubator.

Primary neonatal rat ventricular cardiomyocytes (NRVCs) were isolated from 1- to 3-day-old Wistar neonatal rats as previously described [37]. Primary NRVCs were seeded in a 6-well plate with DMEM/F12 medium (11,320,033, Gibco, USA) containing 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin then preincubated for 1.5 h to remove cardiac fibroblasts. Finally, purified NRVCs were cultured in a CO2 incubator at 37 °C for 72 h.

In order to induce in vitro myocardial lipotoxicity, as described in a previous article [8]. H9c2 cells were treated for 24 h with 250 µM PA (Sigma-Aldrich, St. Louis, MO), whereas NRVCs were treated for 48 h with 150 µM PA.

RNA fluorescence in situ hybridization(FISH)

RNA-FISH was performed according to the manufacturer’s instructions using the FISH detection kit (G3017, Servicebio, Wuhan, China). The circ_005077 specific probe (5′AGGAGCCGGTCACTCTTTGTCCTGCACTAG3′) was designed and synthesized by Servicebio. After prehybridization treatment, cells cultured on slides were incubated with probe hybrid solution (1µM) in a wet box at 37 °C overnight, After washing with sodium citrate saline buffer, DAPI was added to re-dye the nucleus. Cells were observed and analyzed under a confocal microscope (AXR, Nikon, Japan).

RNA stability testing

H9c2 cells were treated with 5 µg/ml actinomycin D (HY-17,559, MCE, USA) when they reached 70–80% confluence in 6-well plates and collected at different time points. Total RNA was extracted from collected cells and the levels of circ_005077 and the corresponding linear RNA (crmp1 mRNA) were analyzed by qRT-PCR.

For the RNase R treatment, 5 µg total RNA was incubated for 15 min at 37 °C with or without 3 U/µg RNase R (RNR16404, Lucigen, USA). qRT-PCR was used to detect circ_005077 and crmp1 mRNA levels after RNase R treatment.

Transfection of cells and establishment of stable transformation cell lines

Hanbio Tech (Shanghai, China) designed and synthesized the plasmids (pcDNA3.1-Ppia, pcDNA3.1-Ncf1, and their control vector pcDNA3.1). Meanwhile, small interfering RNAs (siRNAs), including siRNA-circ_007077, siRNA-Ppia, siRNA-Ncf1, and negative control were designed and synthesized by RiboBio (Guangzhou, China). According to the manufacturer’s protocols, the plasmids and siRNAs were transfected into cells using the Lipofectamine 3000 Transfection Kit (Invitrogen, Carlsbad, CA).

Lentivirus carrying the circ_005077 sequence or short hairpin RNA (shRNA) targeting rno-circ_005077 and their corresponding control vectors designed and synthesized by Hanbio Tech were used to infect H9c2 cells. Forty-eight hours after infection, cells were subjected to puromycin treatment for two weeks to construct cell lines that stably overexpress or silence circ_005077.

RNA sequencing

Total RNA was extracted and quantified in the same manner as mentioned earlier. The RNA was tested for integrity using a Bioanalyzer 2100 (Agilent, CA, USA) and confirmed using agarose electrophoresis. PolyA (polyadenylate) RNA was specifically captured using Dynabeads Oligo (dT)25-61005, (Thermo Fisher, CA, USA) through two rounds of purification. The captured mRNA was fragmented into small pieces at 94 °C for 5–7 min using the magnesium RNA fragmentation module (E6150, NEB, USA). SuperScript™ II synthesized cDNA reverse transcriptase (1,896,649, Invitrogen, USA), then E. coli DNA polymerase I (m0209, NEB, USA) and RNase H (m0297, NEB, USA) were used for double-stranded synthesis to synthesize U-labeled second-stranded DNAs, dUTP solution (R0133, Thermo Fisher, USA) was added to make the ends of double-stranded DNA flat. An A-base was added to each end to connect with the terminal joint with a T-base; then, the AMPureXP beads were used to screen and purify their fragment size. The U-labeled second-strand DNAs were digested with the UDG enzyme (m0280, NEB, USA), then predenatured by PCR, at 95 ° for 3 min, denatured at 98 ° for 15 s with eight cycles, annealed at 60 ° for 15 s, extended at 72 ° for 30 s, and finally extended at 72 ° for 5 min. The average insert size for the final cDNA library was 300 ± 50 bp. Ultimately, the vendor-recommended methodology was followed while performing the paired-end sequencing (PE150) on an Illumina NovaseqTM 6000 (LC-Bio Technology Co., Ltd., Hangzhou, China).

Based on the analysis of significant differences between samples, genes with a difference FC > 2 times or a difference FC < 0.5 times and a p-value of < 0.05 were defined as differential genes, and then Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed.

Chromatin isolation by RNA purification (ChIRP)

The proteins binding to circRNA were detected using the ChIRP method as previously described [38]. The biotin-labeled antisense probes were designed at the back-spliced site of circ_005077 and synthesized by RiboBio. A total of 2 × 107 cells were collected, cross-linked with 3% formaldehyde solution for 30 min at room temperature, and then cell lysate was prepared using lysis buffer. The biotin-labeled probes were combined with magnetic beads for 30 min, followed by mixing with the sample for hybridization overnight at 37 °C. The magnetic beads were washed with 1 ml of wash buffer at 37 °C five times, collected using a magnetic frame, and mixed with protein elution buffer and dithiothreitol at 37 °C for 2 h. Magnetic beads were re-collected, and the supernatant (protein sample) was transferred to a new centrifuge tube for chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) or Western blotting detection.

LC-MS/MS

The nano-UPLC liquid phase system EASY-nLC1200 was used to divide each sample into 5 µl polypeptides, and the polypeptides were identified using an online mass spectrometer (Q-Exactive). The enzymatic hydrolysate was separated via nano-UPLC and then analyzed online using a Q-Exactive mass spectrometer (Thermo Finnigan). MaxQuant (version 2.0.1.0) searched and quantitatively analyzed the LC-MS/MS raw data. The protein database was uniprot-proteome-rat-2021.2. FASTA. To enrich U1snRNA and identify the binding protein, a specific probe of U1snRNA was used as the positive control group (PC). Nonspecific antisense was used in the negative control group. The proteins precipitated by the circ_005077 probes were quantified based on the fold-change of normalized spectral counts relative to the negative control. The results of the ChIRP-MS assay are listed in Table S5B.

RNA immunoprecipitation (RIP) and immunoprecipitation (IP)

Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17–700, Millipore, USA) was used for RIP experiments in accordance with previously mentioned manufacturer’s instructions [39]. Cell lysates were incubated with 5 µg of CyPA primary antibodies (sc-134,310, Santa Cruz Biotechnology, USA). Mouse immunoglobulin (IgG) was used as a control. Western blot and qRT-PCR were used to detect the final product.

IP experiments were used with the IP Kit with Protein A + G Magnetic Beads (P2179S, Beyotime Biotechnology, China) and the Flag-Tag Protein IP Assay Kit with Magnetic Beads (P2181S, Beyotime Biotechnology, China). In Brief, the pretreated magnetic beads and the diluted CyPA (1 µg per 100 µg of total protein) of tris-buffered saline were flipped and incubated on a flip mixer for 1 h at room temperature. The above step was omitted in flag-tag magnetic beads. The magnetic beads were then washed three times and incubated overnight with protein sample lysis buffer at 4 °C on a rotary mixer. The next day, the magnetic beads were eluted with SDS-PAGE sampling buffer, followed by Western blot analysis.

Transmission electron microscopy

In 2.5% glutaraldehyde (G1102, Sevicebio, China), 1mm3 fresh rat heart tissue or 1 × 107 H9c2 cells were fixed overnight at 4 °C. After being rinsed, post-fixed with 1% osmium tetroxide, and gradient dehydration with ethanol, the samples were inserted into the mold in a 37 °C oven overnight. Following entrapment (90529-77-4, SPI, China), ultrathin sections were prepared and stained twice with uranyl acetate and lead citrate. Observation and image analysis under a transmission electron microscope (TEM) (HT7700, Hitachi, Japan).

Glutathione (GSH), malondialdehyde (MDA), lactate dehydrogenase (LDH), and coenzyme II NADP(H) content ass

The determination of the content of GSH (BC1175, Solarbio, China), MDA (S0131, Beyotime, China), LDH (BC0685, Solarbio, China) content and the NADPH/NADP+ ratio (BC1105, Solarbio, China) was carried out according to the manufacturer’s instructions.

Detection of ROS and Liperfluo (LPO) content

Cytoplasmic ROS and mitochondrial ROS were detected by DCFH-DA (S0033S, Beyotime Biotechnology, China) and MitoSOX Deep Red (MT14, Dojindo Laboratories, Japan) following the manufacturer’s instructions, respectively. Briefly, DCFH-DA and MitoSOX were diluted to 1: 1000 dilution in serum-free medium to a final concentration of 10 μm. Cell culture fluids were removed and incubated with the above working solution for 30 min at 37 °C in the dark. Fluorescent signals were quantified by Image J (version 1.53e, National Institutes of Health, USA).

For the detection of cellular LPO, cells were incubated with 5 mm LPO (L248, Dojindo Laboratories, Japan) for 30 min at 37 °C in the dark. Fluorescence images were captured by a confocal microscope and analyzed using Image J.

Measurement of Fe2 + content

Cells were incubated in the dark for 30 min at 37 °C with 1 µM FerroOrange working solution (F374, Dojindo Laboratories, Japan) to measure cellular Fe2 + content. A confocal microscope was used to capture the fluorescence images, which were then analyzed using Image J.

Protein stability testing

To test whether CyPA stability was affected by circ-005077, H9c2 cells that stably overexpress or silencing rno-circ_005077 were treated with 10 µM proteasome inhibitor MG-132 (HY-13,259, MCE, USA) or 30 µM protein synthesis inhibitor cycloheximide (CHX) (HY-12,320, MCE, USA) according to the previous report [40]. After treatment, the proteins were isolated and the expression of CyPA was detected by Western blotting.

Measurement of NADPH oxidase activity

The levels of NADPH oxidase (NOX) activity levels in rats were measured via ELISA using a NADPH oxidase detection kit (Fusheng Biotech Ltd., Shanghai, China) following manufacturer’s instructions. The absorbance (optical density) was measured via a microplate reader (UV-visible Spectrometer Uv300, UK) at a wavelength of 450 nm, and the activity of NOX in the sample was calculated by standard curve.

Western blotting

Cells were harvested and lysed with RIPA buffer supplemented with protease and phosphatase inhibitors on ice for 30 min. Protein concentration was quantified using the BCA Protein Assay Kit (P0012, Beyotime Biotechnology, China) Equal amounts of protein were electrophoretically separated on 7.5% or 12.5% polyacrylamide gels before being transferred to polyvinylidene fluoride membranes. The membranes were incubated with primary antibodies after blocking with Protein Free Rapid Blocking Buffer (PS108P, EpiZyme Biotechnology, China) for 45 min at room temperature, including rabbit polyclonal to CyPA (1:2000, ab41684, abcam), mouse monoclonal to CyPA (1:1000, sc-134,310, Santa Cruz Biotechnology), rabbit monoclonal to NCF1/p47-phox (1:1000, ab308256, abcam), rabbit monoclonal to FTH1 (1:1000, ab183781, abcam), rabbit monoclonal to GPX4(1:5000, ab125066, abcam), rabbit monoclonal to FACL4(1:10000, ab155282, abcam), rabbit monoclonal to COX2 (1:5000, ab179800, abcam), mouse monoclonal to transferrin receptor (1:5000, ab269513, abcam), rabbit monoclonal to PDIA6 (1:10000, ab154820, abcam), mouse monoclonal to P4HB (1:1000, ab2792, abcam), rabbit polyclonal to ERp57/ERp60 (1:2000, 15967-1-AP, proteintech), mouse to DYKDDDDK-Tag(1:5000, M20008, abmart), mouse to HA-Tag (1:5000, M20003, abmart), rabbit polyclonal to ubiquitin(1:1000, 10201-2-AP, proteintech), or rabbit recombinant antibody to Beta Actin(1:10000, 81115-1-RR, proteintech) at 4 °C overnight. Subsequently, the membranes were washed three times, followed by incubation with HRP-conjugated affinipure goat anti-rabbit IgG (H + L) (1:10000, SA00001-2, proteintech) or HRP-conjugated affinipure goat anti-mouse IgG (H + L) (1:10000, SA00001-2, proteintech) secondary antibodies for 1 h at room temperature. ECL chemiluminescence was captured using the automatic chemiluminescence image analysis system (5200, Tanon, China).

Immunohistochemistry (IHC)

The paraffin sections were deparaffinized in xylene and rehydrated in alcohol. After antigen recovery, the slices were treated with hydrogen peroxide (H2O2) and goat serum, followed by incubation with anti-FTH1(1:200, ab183781), anti-GPX4 (1:200, ab125066), anti-ACSL4(1:200, ab155282), anti-TFRC (1:200, ab269513) and anti-COX2 (1:200, ab179800) at 4 °C overnight. After being washed three times, the slices were further incubated with secondary antibodies at 37 °C for 1 h. Following hematoxylin staining and differentiation with 1% hydrochloric acid alcohol, these slices were dehydrated in alcohol, xylene transparent, and photographed under a microscope (Aperio Versa 8, Leica, Germany).

Statistical analysis

Data were presented as mean ± standard deviation (SD) and statistically analyzed with SPSS version 17.0 software (SPSS, Inc., Chicago, IL, USA). The Student’s t-test was used to examine the variations between the two groups. A one-way analysis of variance was first used to examine differences between more than two groups. Multiple comparison analysis was conducted using Fisher’s least significant difference test when appropriate and suitable. A statistically significant difference was defined as P < 0.05.