Ethics approval and consent to participate

Animal study (L102012021110J) was performed with the permission of the institutional committee of Sun Yat-sen University Cancer Center, in compliance with protocols approved by the Guangdong Provincial Animal Care and Use Committee and experimental guidelines of the Animal Experimentation Ethics Committee of Sun Yat-sen University Cancer Center. All blood specimens were obtained at the Sun Yat-sen University Cancer Center under the study protocols SL-G2022-020-01, approved by ethics committee of Sun Yat-sen University Cancer Center.

Patients

CRC patients who were diagnosed for the first time or who developed progressive disease after extensive treatment; or randomly selected NSCLC, HCC as well as BC patients were recruited for the study. The study protocol SL-G2022-020-01 was approved by the research ethics committee of Sun Yat-sen University Cancer Center. After obtaining written informed consent from the subjects, peripheral blood samples (5–10 mL) were drawn at the Sun Yat-sen University Cancer Center in EDTA vacutainers. All blood specimens were obtained at the Sun Yat-sen University Cancer Center under the study protocols SL-G2022-020-01, approved by ethics committee of Sun Yat-sen University Cancer Center. Patients who were affected by two or more tumor types at the same time were excluded from the study.

Cell culture

Human colorectal cancer cell lines (Caco2, DLD1, THC8307), mouse colorectal cancer cell line (CT26), human leukemia cell lines (Jurkat, THP1) were obtained from the American Type Culture Collection, ATCC. They were grown in RPMI 1640 medium (C11875500BT, GIBICO) supplemented with 10% fetal bovine serum (03-033-1BCS, BI), 100 U/mL penicillin (H44022447, TIANXIN), 100 U/mL streptomycin (H37020187, LKPC) in a humidified incubator at 37 °C with 5% CO2. Peripheral blood monocytes (PBMCs) isolated from healthy donors using PBMC Isolation Kit (P8610, Solarbio) were cultured in the above complete medium supplemented with 150 U/mL IL-2. HEK293T and Raw264.7 cells were maintained in DMEM medium (C11995500BT, GIBICO) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 U/mL streptomycin in a humidified incubator at 37 °C with 5% CO2.

CTC capture

Human CTCs were isolated from unprocessed peripheral blood samples within 2 h of blood collection according to the procedure recommended for using the Cellab Thomas I CTCs processing workstation. Briefly, 5–10 mL EDTA-anticoagulated blood samples obtained from cancer patients were centrifuged at 500 g for 10 min to remove plasma. Then, an equivalent volume of CTCs preservation solution was gently added to the blood tubes and uniformly mixed. CTCs were separated and enriched from the blood samples within 20 min. The isolated CTCs were used directly in biological assays or maintained in culture.

CTCs capturing using NextCTC and downstream CEP8 staining

Fresh blood samples from cancer patients were immediately performed RBC lysis for 5 min at room temperature. After harvesting cell pellets by 1300 rpm centrifugation for 5 min, they were resuspended with PBS and used for CTCs isolation using NextCTC CTC-capturing apparatus from FOCUSGEN. CTC solutions were centrifugated at 1300 rpm for 10 min to conserve CTCs solutions 100 μL. The solutions were prefixation with CF1 1–2 µL and used for cell smear on the glass slides. After making sure the glass slides were dry at 50 °C, the slides underwent fixation with CF2 100 µL for 7 min, aging at 37 °C for 30 min, dehydration in 75% ethyl alcohol for 1 min and absolute ethyl alcohol for 1 min. Then CEP8 probe reagent 10 µL was added onto the slides and performing probe hybridization in the PCR amplifier at 75 °C/12 min, 37 °C/4 h. The slides were successively washed in solution A twice for 2 min and solution B at 60–68 °C for 3 min, then washed in solution A for 2 min and in PBS twice for 2 min. Once the slides were dry, FITC-CD45 antibody was added with a dilution ratio 1:100 at 4 °C overnight in the dark place. After washed with PBS twice for 2 min and added DAPI for 10 min, another twice washing with PBS for 2 min was necessary for the next fluorescence observation. The red CEP8 phosphor dots ≥ 3 in the cell nucleus was considered malignant. The CTCs-FISH Kit (including CEP8, FITC-CD45 and other buffer solutions used here) is from FOCUSGEN.

CTC short-period culture in vitro

FACS sorted CTCs were grown in ultralow attachment 96-well round bottom plates (7007, Corning) containing CTC culture medium. The medium is composed of RPMI-1640 medium and a series of growth factors and inhibitors including EGF (20 ng/mL, 78006.2, Stemcell), bFGF (20 ng/mL, 78003.2, Stemcell), HGF (20 ng/mL, 78019.2, Stemcell), Y-27632 (10 μM, S1049, Selleck), Acetylcysteine (1.25 mM, T0875, TargetMol), L-glutamine (200 mM, T0326L, TargetMol), N-2 Supplement (0.5×, 17502048, ThermoFisher) and B27 (0.5×,17504044, GIBCO). For quantifying the change of CD45+ CTCs percentage, sorted cells were divides into two tubes. One is immediately fixed with 4% PFA for later immunofluorescence staining and another is transferred into the CTC culture wells and cultured in a humid 37 °C incubator with 5% CO2 and 4% O2 for 72 h. After that, both 4% PFA-fixed cells were used for immunofluorescence staining.

Extracellular vesicles isolation

Jurkat and THP1 cells were cultured in RPMI 1640 medium containing 1% EVs-depleted FBS at a density of 2 million cells per mL medium. HEK293T cells overexpressed CD45-GFP fusions or Raw264.7 cells were cultured in DMEM medium containing 10% FBS up to a confluency of about 80%. Then, the culture medium was replaced with DMEM medium containing 1% EVs-depleted FBS. Tumor cell-derived conditioned medium was collected after 48 h of culture, and EVs were isolated by differential centrifugation using the EVs isolation protocol as described previously.48 Briefly, after removing cells and debris by centrifugation at 500 g for 5 min and filtration with 0.45 um sterile filters (SLHVR33RB, Millipore), the supernatant was harvested and centrifuged at 15,000 g for 45 min to remove large extracellular vesicles. Finally, the supernatant was centrifuged at 100,000 g for 90 min (All ultracentrifugation steps were performed using Beckman Coulter Avanti J30I at 4 °C). Sedimented EVs were re-suspended and washed in PBS followed by another ultracentrifugation procedure (100,000 g, 90 min) and the pellet was resuspended in 200 μL PBS.

For sucrose density gradient centrifugation, the pellet collected from ultracentrifugation (100 μg) was overlaid with a linear sucrose density gradient (10–70% w/v, pH 7.4) created by a gradient fractionator (Biocomp YIQI 113) in a SW41 tube (Beckman Coulter). The gradients were subjected to ultracentrifugation (Beckman Coulter OptimaTM L-100 XP) at 100,000 g for 16 h at 4 °C. Gradient fractions (1 mL) were collected from top to bottom and then the fractions were washed in PBS followed by ultracentrifugation (Beckman Coulter OptimaTM MAX-XP) at 100,000 g at 4 °C for 2 h. Sediments from the fractions were directly lysed in RIPA buffer for further immunoblot analysis.

For plasma EVs isolation, EDTA-anticoagulated blood samples (3–5 mL) obtained from cancer patients were firstly centrifuged with 500 g for 10 min to harvest about 1 mL of plasma, they were then diluted with equal volume of PBS, filtered, and ultracentrifuged (Beckman Coulter OptimaTM MAX-XP) sequentially at 15,000 g at 4 °C for 1 h and 100,000 g at 4 °C for 2 h. The sediments were resuspended in 100 uL PBS for further immunoblotting analysis, nano-flow cytometry and ELISA assay.

Nanoparticle tracking analysis

The Nanosight NS300 system (Nanosight Technology, Malvern, UK) was used to analyze the number and size distribution of fresh EVs according to manufacturer’s instructions.

Transmission electron microscope imaging

Fresh EVs collected from supernatant of 10 million Jurkat cells were resuspended in 50 μL ice-cold PBS and were negatively stained with 2% uranyl acetate solution and imaged by the Tecnai G2 SpiritTwin electron microscope (FEI).

Immunofluorescence staining

For CTCs staining, CTC suspension was centrifuged at 250 g for 5 min to concentrate the CTCs into 50 uL suspension, which was then precipitated for 15 min on poly-lysine precoated well of 96-well plate (165305, Thermo Fisher). Cells were fixed in 4% paraformaldehyde for 15 min and permeabilized for 10 min in 0.2% Triton-X100. Following 1 h blocking with 4% bovine serum albumin, the CTC specimens were co-stained with pan-cytokeratin monoclonal antibody conjugated with Alexa FlourTM 488 (53-9003-82, Thermo Fisher), PE mouse anti-human CD45 (555483, BD PharmingenTM), anti-CD45 (ab40763, Abcam) antibody, FITC anti-human CD326 (EpCAM, FHF326-01-100, 4Abio), CoraLite488-conjugated Vimentin mouse monoclonal antibody (CL488-60330, Proteintech), anti-HER2 (18299-1-AP, Proteintech) antibody and DAPI (D001, MDbio). The secondary antibody used for detecting CD45 and HER2 are anti-rabbit IgG-AF568 (A11011, Invitrogen) and anti-rabbit IgG-AF488 (A32790, Invitrogen), respectively. For adherent cells, cells were precultured with different conditions on the 35 mm confocal plate and then they were fixed following the staining procedure described above. The images were captured and analyzed by confocal laser microscope LSM880, confocal living cell imager Nikon CSU-W1, or fluorescence microscope Nikon ECLIPSE Ti2. To visualize the colocalization of CD45 and CD3ε (ab16669, Abcam), super-resolution microscope N-SIM/N-STORM was also used.

T cells mediated tumor killing

The tumor cells used for T cells killing included: (i) CD45+ DLD1 and CD45− DLD1 cells sorted from parent DLD1 cells after previous indirect coculture with Jurkat cells; (ii) DLD1 cells pre-incubated with Jurkat cell-derived EVs for 12 h to acquire CD45 expression; (iii & iv) DLD1 and Caco2 cells overexpressing CD45 or not, separately. They were plated at a density of 25,000 cells per well in 24-well plates and then co-cultured with PBMCs at PBMC-to-tumor cell ratios (E:T) of 0:1, 1:1, 2:1, or 4:1 for at least 72 h until the cell density of the control group reached 90%. Afterwards, the wells were washed with PBS twice to remove PBMCs and the adherent and surviving tumor cells were fixed with 4% paraformaldehyde and stained with 0.05% crystal violet solution. Colorimetric analysis was used to determine the viability of tumor cells.

NK cell killing assay

NK cells were sorted from 10 mL peripheral blood of heathy donors. In short, WBCs were harvested by RBC lysis for 5 min at room temperature. After washed with PBS twice and diluted with 2% FBS PBS, the following antibody were added to the solution and kept on ice in dark for 30 min: (1) PE anti-human CD45 (304008, Biolegend); (2) PerCP anti-human CD3 (317337, Biolegend); (3) FITC anti-human CD56 (NCAM) (318303, Biolegend). CD45+ CD3− CD56+ NK cells were sorted using Overspeed flow cytometer for cell sorting (MoFlo Astrios, Beckman-Coulter). Before NK cell killing of cancer cells, Caco2 cells were stained with Calcein Live Cell staining Kit (CA1630-500T, Solarbio) for 30 min at 37 °C. The cell culture medium used for the NK cell killing assay was RPMI-1640 containing 10% FBS, 1000 U/mL IL-2, 10 ng/mL IL-15 (200-15-2, PeproTech). NK cells were cocultured with calcein-stained Caco2 cells (with effector-to-target ratios of 80:8, 40:8, 20:8, 10:8, 5:8) in U-type 96-well plates for 4 h. Then the plates were centrifuged at 100 g for 5 min, 100 μL medium from each well was carefully transferred into new 96-well plates and the released calcein-fluorescence from each well was measured by TECAN multifunctional enzyme labeling instrument (Spark 10 M). The percentages of lysis were calculated and presented as: (Rtest - Rauto) / (Rmax - Rauto) × 100% (Rmax means released calcein-fluorescence from wells of calcein-stained Caco2 cells treated with 2%Triton-X100, Rauto means released calcein-fluorescence from wells of calcein-stained Caco2 cells without any treatment).

Constructs

The C-terminus CD45-GFP, N-terminus HA-CD45 and MYC-CD45 fusion constructs were generated by ligating the CD45 coding sequence (NM_002838.5) with a GFP, HA, and MYC tag, respectively, into the pLVX-MCS-Puro lentiviral expression vector using standard molecular cloning techniques. Exons 5 and 6 of PTPRC were removed to generate CD45RA whereas exons 4, 5 and 6 of PTPRC were removed to produce CD45RO according to the manufacturer’s protocol. In addition, truncated HA-CD45Δ430-436 and MYC-CD45Δ430-436 were also produced. Besides, CTAG1B encoding NY-ESO-1 was ligated into pLVX-IRES-Neo. CRISPR RNA (crRNA) targeting PTPRC (Forward primer: CCAAATGGTAACGTTCATGG), Ptprc (Forward primer: ATACTATTGTCTGTCGGCC), Rab27a (Forward primer: GTACTCTACCAGTACACTGA) and a negative control (NC) sequence (Forward primer: CGCGATAGCGCGAATATATT) were constructed into the lentiviral transfer plasmid CRISPR/Cas9 LentiCRISPR V2. pLKO.1-puro was used to mediate shRNA expression of RAB27A (Forward primer: CCAGTGTACTTTACCAATATA). These lentiviral constructs were co-transfected with psPAX2 and pMD2.G at a ratio of 4:3:1 into HEK293T cells using Lipofectamine 2000 (11668019, Thermo Fisher) in Opti-MEM medium. The total DNA-to-Lipofectamine 2000 ratio was maintained at a ratio of 1:2 during the transfection. After 6 h of transfection, the medium was replaced with fresh DMEM and the supernatants containing viral particles were then collected from the cells after 48 h. The supernatants were then subjected to filtration using 0.45 μm PES filter and were used to transfect cancer cells with polybrene (8 μg/mL) for 48 h. Stably transfected cells were maintained in either puromycin dihydrochloride (5 μg/mL, 0219453925, MP) or G418 sulfate (500 μg/mL, ST081, Beyotime) and expression of protein of interest was confirmed by immunoblotting. Lentiviral vector was used for transduction of suspension cells using the spinfection protocol. The sequence of HLA-A2-restricted TCR (1G4-TCR) that specifically recognizes NY-ESO-1 (SLLMWITQC) was synthesized and cloned into a 3× FLAG-tag bearing pLVX-MCS-Puro. Jurkat cells were spinfected (2000 g for 90 min, 25 °C) in virus-containing medium with 8 μg/mL polybrene for transfection. The medium was replaced with fresh medium after transfection for 24 h. The sequence of the constructs was confirmed by GUANGZHOU RUIBIO TECHNOLOGY.

Immunoblotting

Protein lysates from freshly collected tumor cells or frozen tumor tissues were generated using RIPA buffer supplemented with protease inhibitor cocktail (C0001, TargetMol). The protein concentrations in lysates were determined using BCA Protein Assay Kit (XYM-THE-23227, biosharp). The lysates were electrophoresed in 8–12% SDS-PAGE gel and the separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (IPVH00010, Millipore) for antibody incubation. After blocking with 5% skimmed milk, PVDF membranes were blotted with primary antibodies (1:1,000-1:2,000 dilution) overnight at 4 °C and secondary antibody (1:10,000 dilution) for 1 h at room temperature. Protein bands were visualized by ECL imaging (Clarity Western ECL Substrate, 1705061, Bio-Rad) using Bio-Rad ChemiDoc Imaging System. Detailed antibody information was listed as following: CD45 (60287-1-Ig, Proteintech), CD63 (ab59479, Abcam), GAPDH (60004-1-Ig, Proteintech), TSG101 (DF8427, Affinity), Calnexin (AF5362, Affinity), CD31 (11265-1-AP, Proteintech), CD9 (20597-1-AP, Proteintech), RAB27A (DF6702, Affinity), GFP tag (50430-2-AP, Proteintech), ZAP-70 (AF8390, Beyotime), Phospho-ZAP70 (Tyr319) (p-ZAP70, AF5968, Beyotime), CD3ζ (AF0096, Beyotime), Phospho-CD3ζ (Tyr142) (p-CD3ζ, AF5425, Affinity Biosciences), ERK1/2 (ERK, 51068-1-AP, Proteintech), Phospho-ERK1/2 (Thr202/Tyr204) (p-ERK, 28733-1-AP, Proteintech), AKT (60203-2-Ig, Proteintech), Phospho-AKT (Ser473) (p-AKT, 66444-1-Ig, Proteintech), PLCγ1 (2822 S, CST), Phospho-PLCγ1 (Tyr783) (p-PLCγ1, 2821 S, CST), NY-ESO-1(19521-1-AP, Proteintech), HLA-ABC (15240-1-AP, Proteintech), HA tag (51064-2-AP, Proteintech), MYC tag (16286-1-AP, Proteintech).

Co-immunoprecipitation

HEK293T cells overexpressing MYC-CD45 or HA-CD45 (as well as HEK293T-HA-CD45Δ430-436 cells and HEK293T-MYC-CD45Δ430-436 cells) were cocultured at a 1:1 ratio in the ultra-low attachment culture plate for 3 h. The cells were then harvested and lysed by NP40 lysis buffer supplemented with protease inhibitor cocktail (C0001, TargetMol). After centrifugation at 140,000 g for 10 min at 4 °C, the supernatants were collected and incubated with HA-tag Rabbit antibody (51064-2-AP, Proteintech) 10 μg/mL or MYC-tag Rabbit antibody (16286-1-AP, Proteintech) 15 μg/mL overnight at 4 °C. Protein A/G Magnetic Beads (B23202, Bimake) were used for the immunoprecipitation (1 h incubation at room temperature) to pull down the IgG-bound proteins. The immunoprecipitated protein samples were further analyzed by immunoblotting. Similarly, Jurkat-sgCD45-CD45GFP and Caco2-HA-CD45 cells were also cocultured to perform the co-immunoprecipitation assay.

Flow cytometry

Anti-human or anti-mouse antibodies were fluorescence-conjugated. Carboxyfluorescein succinimidyl ester (CFSE) cell labelling kit (HY-D0938, MCE) was used for the fluorescent intracellular labelling of live cells. Briefly, freshly collected cells were washed twice and then incubated with desired antibody in 100 μL PBS on ice for 20 min. The samples were then washed twice and resuspended in 200 μL PBS for data acquisition using a cytoFLEX flow cytometer within 2 h. To detect the T cell activation marker CD69, Jurkat-TCR cells were cocultured with Caco2-NYESO1 cells or Caco2-NYESO1-CD45 cells for 24 h, CD69 expression in the Jurkat-TCR cells was analyzed by using FITC conjugated anti-human CD69 antibody (310904, Biolegend).

For nano-flow cytometry, EVs were resuspended in 100 μL PBS (0.1 μm filter filtration) and added 4 μL FITC anti-human CD9 (312103, Biolegend), 4 μL APC anti-human CD45 (304012, Biolegend), 4 μL PE anti-human CD61 (336406, Biolegend). All these antibodies were centrifuged at 17,000 g for 30 min to exclude impurity effect before adding. After incubating at 4 °C for 1 h, the samples were diluted with 300 μL PBS (0.1 μm filter filtration). Nano-flow cytometry analysis of EVs were performed according to the protocol of the CytoFLEX flow analyzer with 405 nm laser.

Other antibodies and regents used for flow cytometry analysis were listed as following: Rabbit IgG Fluorescein-conjugated Antibody (F0112, R&D), Mouse IgG1 PE-conjugated Antibody (IC002P, R&D), FITC anti-human HLA-A2 (343303, Biolegend), PE anti-human CD3 (12-0039-42, eBioscience), PKH 26 Red Fluorescent Cell Linker Mini Kit (MINI26, Sigma-Aldrich), IFN-γ (CI57-10, NovoProtein), 30% H2O2 (66005, MDbio), Chlorpromazine (C424348, Aladdin).

ELISA

CD45 expression of EVs harvested from plasma or supernatant of Jurkat-Ctrl cells, Jurkat-sgCD45 cells, Jurkat-shRAB27A cells were measured by the Human CD45 ELISA Kit (DG12518H, Dogesce). To assess the cytotoxicity of T cells, the release of IFN-γ (1110002, DAKEWE), TNF-α (1117202, DAKEWE), and IL-2 (1110202, DAKEWE) was detected in the supernatants of PBMCs after 16 h co-culture incubation with tumor cells at a 4:1 ratio.

qRT-PCR

RNA extraction from interested cells using EZ-press RNA Purification Kit (B0004D, EZBioscience). Ensure proper handling and storage of RNA to maintain its integrity. Convert the extracted RNA into complementary DNA (cDNA) using a reverse transcription reaction using Color Reverse Transcription Kit (with gDNA Remover) (A0010CGQ, EZBioscience). Prepare the PCR reaction mixture containing the cDNA template, gene-specific primers (GAPDH Forward: TTCTTTTGCGTCGCCAGCC, PTPRC Forward: GACACGGCTGACTTCCAGAT) and Color qPCR reagent kit (A0012-R1, EZBioscience). Perform the PCR amplification using qPCR ROCHE 480 instrument. The qRT-PCR data was analyzed by GraphPad Prism 8 using Student’s t test.

Cancer cell proliferation assay

For proliferation assay, DLD1-Vector, DLD1-CD45, DLD1-CD45RA, DLD1-CD45RO cells (3000 cells each) were seeded into 96-well plates and cultured with RPMI 1640 containing 10% FBS. After different duration of cell growth (1, 3, 5, and 7 days), 20 μL MTT solution (5 mg/mL) was added into each well of the different groups and incubated for 4 h at 37 °C. MTT crystal was dissolved in 100 uL DMSO after discarding the supernatant from each well. Cell proliferation was then assessed by measuring the optical density at 570 nm (630 nm as reference wavelength) using a microplate reader (Bio-Rad). The experiments were carried out three times.

Ca2+ influx assay

In brief, Jurkat cells (3 million cells) were washed and resuspended in 500 μL dilution buffer containing Fluo-8AM and Pluronic F127 (C0012, APPLYGEN) for a 30 min incubation at room temperature. DLD1 or Caco2 overexpressing CD45 were stained with PKH 26 at room temperature, washed, resuspended in dilution buffer, and placed on ice. Jurkat cells were then washed and resuspended at a density of 3 million cells per mL in dilution buffer The Ca2+ influx of Jurkat cells alone or in the presence of equal volume of tumor cells (half the number of Jurkat cells) with or without the anti-CD3 antibody (OKT3) 5 μg/mL shock was analyzed within 7 min using an ACEA NovoCyte flow cytometry.

Proximity ligation assay

HEK293T cells overexpressing MYC-CD45 or HA-CD45 (Another group is Jurkat-sgCD45-CD45GFP and Caco2-HA-CD45 cells) were cocultured at a 1:1 ratio in the ultra-low attachment culture plate for 3 h. Then they were harvested for fixation and permeabilization. After incubation in blocking buffer at 37 °C for 1 h, the cells were incubated with HA-tag mouse antibody (RM1004, Ray antibody) 1:50 and MYC-tag rabbit antibody (16286-1-AP, Proteintech) 1:50. The proximity ligation assay was performed using Duolink® In Situ Detection Regents Red (DUO92008, Sigmaaldrich) according to the manufacturer’s instructions. Fluorescent images indicating protein-protein interactions were captured by the Zeiss LSM880 confocal laser scanning microscope.

Establishment of in vivo tumor xenograft and metastatic tumor models

All experiments were conducted according to the protocol approved by Sun Yat-Sen University Institutional Animal Care and Use Committee (L102012021110J). Immunodeficient Balb/C nude or immunocompetent Balb/C female mice (4-week-old) were obtained from GDMLAC or Gempharmatech-GD for all experiments. Balb/C or Balb/C nude mice were implanted with tumor xenografts by subcutaneously injecting 5 × 105 CT26 cells into the bilateral flank. For one group, the left flank is implanted with CT26-Vector cells whereas the right flank is implanted with CT26-CD45 cells. For the other group, both flanks were implanted with CT26-Vector cells. Equal volumes of PBS and Raw 264.7-derived EVs (120 μg/mL, 3 μg/mouse) were injected into the tumors in the left and right flank every 3 days. The tumor size was assessed every 3 days with electronic calipers. When the maximum tumor diameter reached 15 mm, the experiment was terminated. The tumor volume was calculated using the formula: tumor volume = length × width2 / 2. For unilateral subcutaneous tumor xenografts, 6 × 105 CT26 cells were used. And for each group, equal volumes of PBS or Raw 264.7-sgNC-derived EVs (EVs-sgNC), Raw 264.7-sgPtprc-derived EVs (EVs-sgPtprc), Raw 264.7-sgRab27a-derived EVs (EVs-sgRab27a) (120 μg/mL, 3 μg/mouse) were used with the similar process. For metastatic tumor models, CT26-Vector and CT26-CD45 cells transfected with luciferase plasmid were used to evaluate the extent of tumor metastasis by either (i) using a fixed cell number of 3 × 105 cells per mouse; or (ii) using 104 cells, 103 cells, 102 cells per mouse in a limiting dilution manner, after intracardiac injection of Balb/C mice. Briefly, Balb/C mice were randomly assigned to the control or CD45 groups and anesthetized with trimethylamine (T48402, Sigma-Aldrich) 0.2 mg/g mouse weight. The indicated number of CT26 cells were resuspended in 60 μL PBS and injected intracardially into the circulation of mice. Metastasis onset and growth rate were non-invasively monitored weekly with the In Vivo Imaging System (IS2014N7915, Andor, iKon) during the observation period of the experiment. Hematoxylin and eosin staining (H&E staining) of mouse body tissues was also conducted to evaluate metastasis foci at the time of experiment termination. For the fixed cancer cell number metastasis study, the experimental animals were observed for up to 3 weeks. For the limiting-dilution metastasis study, the formation of lung metastases after intracardiac injection of cancer cells was monitored for up to 10 weeks. For flow cytometric analysis of T cells, single-cell suspensions from tumors were mechanically dissociated using a 70 μm mesh filter. After erythrocyte lysis, fixation and permeabilization, the cell suspensions were blocked with 2% BSA and stained with APC anti-mouse CD3 (BioLegend, 100312) 1:50 dilution, FITC anti-mouse CD8 (BioLegend, 100706) 1:50 dilution, Brilliant Violet 412TM anti-mouse IFN-γ (BioLegend, 505830) 1:50 dilution.

H&E staining

The paraffin-embedded 4 μm tissue sections were collected, mounted on glass slides, and stained with H&E. The cut sections were deparaffinised in xylene and rehydrated in ethanol. Afterwards, the samples were stained with hematoxylin for 5 min and eosin for 3 min, followed by another immersion in alcohol and xylene. The stained slides were scanned using an automated slide scanner (KF-PRO-020).

Immunohistochemistry

The paraffin-embedded 4 μm tissue sections were used for immunohistochemistry staining according to the manufacturer’s protocol (KC-RB-035, KangChen Bio-tech). Briefly, samples were immersed in xylene and alcohol several times. Then antigen retrieval was performed using sodium citrate buffer (pH 6.0) in a pressure cooker for 20 min to remove the aldehyde links. Then the endogenic catalase activity was inactivated using 3% hydrogen peroxide solution. The sections were blocked with 3% BSA for 30 min at room temperature before incubation with primary antibodies against CD8 alpha (ab209775, Abcam, 1:100 dilution) or Granzyme B (ab4059, Abcam, 1:100 dilution) overnight at 4 °C and the anti-rabbit IgG/HRP secondary antibody for 20 min at room temperature. The staining was visualized by using a DAB Substrate Kit (ZLI-9017, ZSGB-BIO) according to the manufacturer’s instruction. The stained slides were scanned using the automated slide scanner (KF-PRO-020) and the data were analyzed using HALO Image Analysis Modules.

FACS sorting CTCs and single-cell CNA sequencing

Each 5 mL peripheral blood from three CRC patients with liver metastasis or multi-organ metastasis was used to isolate interested cells, separately. In addition, 5 mL peripheral blood from a healthy donor was used to set as negative control. After centrifuging at 850 g for 30 min to collect PBMCs using PBMC Isolation Kit, the PBMCs were washed with PBS twice, diluted with 2% FBS PBS and blocked with Human TruStain FcX™ (422301, Biolegend) for 15 min. Then the following antibody were added to the solution and kept on ice in dark for 30 min: (1) PE anti-human CD45 (304008, Biolegend); (2) APC anti-human Lineage Cocktail (CD3/14/16/19/20/56) (348803, Biolegend); (3) FITC anti-human CD326 (FHF326-01-100, 4Abio); (4) Fixable Viability Dye eFluor™ 780 (65-0865-14, eBioscience). Before FACS, ultralow attachment 96-well plates were added 100 μL CTCs culture medium for further in vitro culture and 0.2 mL PCR octuple tubes were added 2 μL PBS with 2% FBS for single-cell CNA sequencing. Three populations of single cells including 65 cells were sorted into the prepared PCR octuple tubes using Overspeed flow cytometer for cell sorting (MoFlo Astrios, Beckman-Coulter): (a) CD45+ Lineage-APC+ WBCs (Lineage contains CD3/14/16/19/20/56); (b) CD45+ Lineage-APC- EpCAM+ CTCs; (c) CD45− EpCAM+ CTCs. The PCR octuple tubes containing sorted cells were immediately transferred into a box filled with dry ice to keep the cell integrity. The msCNVS™ Medium flux single cell DNA copy number variation library construction and sequencing was completed by SequMed Biotech Inc. Its feature is the use of TN5 transposase assembled with specific barcodes, which can obtain the corresponding data for each sample through these barcode records. After the construction of the library was completed, Qubit2.0 was firstly used for preliminary quantity, and then using Agilent 2100 to detect the length of the insertion fragment of the library, thus ensuring the quality of the library. Once the library is qualified, the different libraries are sequenced on the Illumina Novaseq platform after the demand of the amount of data from the valid concentration and target. The sequencing strategy is PE150 and the sequencing is Paired End dual-end sequencing, of which the length of the reads is 150 bp. Bowtie2 was used for comparing sequencing reads with reference sequences, which uses FM indexes (based on Burrows-Wheler Transform or BWT) to index the genome. Two parameters were used to exclude unqualified sample when performing CNA data: Coefficient of Variation (CV > 0.5) and/or Median Bin Count (MBC < 35). Before calculating the mean copy number and CV values, the following will be removed: ① X/Y chromosome; ② Regions containing CNAs (> 2.5 or < 1); ③ Regions of black list.

Crystal structure prediction of CD45 homophilic interactions

Rigid protein–protein docking (ZDOCK) was performed with two same human CD45 extracellular regions, domains d1-d4 to study their dimerization. The PDB format of the protein structural domain was downloaded from the Protein Data Bank (PDB) database (http://www.rcsb.org/). The ZDOCK module was run to identify the docking sites and calculate the ZDOCK scores. Comprehensive analysis such as hydrogen bonds was further performed through PDBePISA (https://www.ebi.ac.uk/pdbe/pisa).

Statistical analysis

The data are presented as means ± SEM. Statistical comparison of experimental groups was determined by unpaired two-tailed Student’s t-test or Mann-Whitney U test unless otherwise indicated. P-value < 0.05 was considered statistically significant. All statistical analyses were conducted by SPSS 22.0 or GraphPad Prism 8.