Our research complies with all relevant ethics regulations of Karolinska Institutet and the Public Health Agency of Sweden. The animals were housed according to Karolinska Institute ethics rules and observed daily. The Stockholm Ethical Committee for animal research approved the research. Ethics clearance for patient sampling was approved by the Turkish Ethical Committee and the Bulgarian Ethical Committee. All volunteers gave written informed consent. The use of these samples for research in Sweden was approved by the Stockholm Regional Ethical Committee (2017/1712-31/2).

Cells and viruses

The cell lines used were HEK293 (ATCC, CRL-1573), HEK293T/17 (HEK293T, ATCC CRL-11268), A549 (ATCC CCL-185), HepG2 (Abcam, AB275467), HepG2 ApoE KO (Abcam, AB280875) and Vero cells (ATCC CCL-81). All cell lines were maintained in Dulbecco’s modified eagle’s medium (DMEM, Life Technologies), supplemented with 10% v/v of heat-inactivated fetal bovine serum (FBS, Life Technologies) and incubated at 37 °C, 95% humidity and 5% CO2. SW13 (ATCC, CCL-105) cells were maintained in Leibovitz’s L15 medium (ThermoFisher) at 37 °C without CO2. Haploid mouse stem cells (mSCs, clone AN3-12) used for the haploid screening were obtained from IMBA (Austria). Haploid mSCs were maintained in standard embryonic stem-cell medium, supplemented with 10% (v/v) FBS (Hyclone), recombinant mouse Leukaemia Inhibitory Factor (LIF) and β-mercaptoethanol at 37 °C, 95% humidity and 5% CO2. Ldlr knockout AN3-12 cells were furnished (and validated) by Haplobank27, IMBA, Vienna. The Hyalomma anatolicum embryo-derived cell lines HAE/CTVM9 were grown in L15/MEM medium (equal volumes of L15 and minimal essential medium with Hank’s salts supplemented with 10% Tryptose Phosphate Broth), both supplemented with 2 mM l-glutamine, 20% FBS and incubated in sealed flasks at 28 °C and 0% CO2 as previously described59. All cell lines were regularly tested for mycoplasma contamination.

VSV-CCHF_G was produced as described below. CCHFV IbAr10200 strain was cultured on SW13 cells. CCHFV clinical strain was isolated on SW13 cells from a Turkish patient serum sampled as part of another project. Ethics clearance was obtained (Nr: 2017/1712-31/2) as well as fully informed patient consent. RVFV strain ZH548 was cultured on Vero cells.

Biosafety

All experiments involving VSV-CCH_G were done in a Biosafety Level 2 laboratory and experiments involving CCHFV were done in a Biosafety Level 4 laboratory in compliance with the Swedish Public Health Agency guidelines (Folkhälsomyndigheten, Stockholm).

Reagents

D-PBS, DMEM, trypsin, PBS, penicillin/streptomycin and FBS were from Gibco (ThermoFisher). Polyethylenimine (PEI) was purchased from Alfa Aesar (ThermoFisher). Unlabelled LDL from human plasma and BOPIDY FL complexed LDL were purchased from ThermoFisher. Human Fc-tagged CCHFV Gc, 6×His-tagged CCHFV Gn and BODIPY-FL complexed CCHFV Gc were purchased from Native Antigen. Coelenterazine h was purchased from Nanolight Technologies. NanoBRET Nano-Glo substrate was purchased from Promega. Trizol was purchased from ThermoFisher. Anti-IFN type I receptor antibody (MAR1-5A3) was purchased from Leico (MAR1-5A3 [5A3]; Leinco Technologies). Soluble LDLR, VLDLR and LRP8 were purchased from R&D Systems.

Pseudotyped virus production and titration

The plasmid pC-G7 expressing the CCHFV glycoproteins Gn and Gc (strain IbAr10200) was kindly provided by Robert A. Davey (Texas Biomedical Research Institute, San Antonio, Texas, USA). The plasmid expressing VSV glycoprotein (pVSV-G) was previously described60. The recombinant VSV encoding the GFP in place of the VSV-G gene (VSVΔG-GFP) was kindly provided by Michael Whitt (University of Tennessee, USA). CCHFV-Gn/Gc-pseudotyped VSVΔG-GFP (CCHFV-pseudotyped virus) was generated as previously described7. Briefly, HEK293T cells were seeded in a T75 flask and 24 h later transfected using the calcium-phosphate protocol with 20 μg of pC-G plasmid; 24 h later, the cells were infected with the recombinant VSVΔG-GFP virus at a multiplicity of infection (MOI) of 4 fluorescent focus-forming units (f.f.u.) per cell. At 16 h.p.i., cell culture supernatants were collected and cell debris were cleared by centrifugation (1,200 g for 7 min at 4 °C). Thereafter, virus particles were pelleted by ultracentrifugation (300,000 g for 150 min at 4 °C) on a 20% (p/v) sucrose cushion in a Beckmann SW 28 Ti swinging-bucket rotor. Pellets were resuspended in 1 ml of ice-cold 1X PBS per tube and mixed. Subsequently, the virus was aliquoted and stored at −80 °C until use. Virus titre was determined by immunofluorescence on Vero cells seeded on 96-well plates. Viral stock was 10-fold serially diluted in DMEM and inoculated on confluent Vero cells for 1 h at 37 °C. Cells were then washed and DMEM supplemented with 10% FBS was added. After 18 h, cells were fixed in chilled methanol/acetone and stained with VSV-M protein (VSV-M [23H12], Kerafast) antibody Alexa Fluor 488-conjugated goat anti-mouse IgG secondary antibodies (ThermoFisher). The fluorescent foci were counted and viral titre was expressed as f.f.u. ml−1. To confirm the functionality of the glycoprotein complex in our experimental conditions, we ran a seroneutralization test with serum from a vaccinated Bulgarian lab worker and with control (unvaccinated people) sera.

Chemical mutagenesis of haploid stem cells

Chemical mutagenesis using ENU was performed as described previously. Briefly, haploid AN3-12 cells were treated for 2 h with 0.1 mg ml−1 ENU in full medium while in suspension and under constant agitation. Cells were washed 5 times and transferred to a culture dish. Cells were left to recover for 48 h, separated using trypsin/EDTA and frozen in 10% DMSO, 40% FBS and 50% full medium. ENU libraries as well as untreated control libraries were shipped to Stockholm for screening experiments using VSV-CCHFV.

Haploid cell screens and analysis

Haploid mSCs (50 million) were thawed and infected with VSV-CCHF_G at a high MOI of 10 (to enhance the likelihood of infecting all susceptible cells) in 5 ml of ES medium without FBS. At 1 h after infection, the cells were supplemented with complete ES medium and incubated at 37 °C with 5% CO2. After outgrowth of virus-resistant cells, cell clones were picked separately and cultured before being validated by infection assay with CCHFV IbAr10200. Briefly, cells (AN3-12 wild-type and potentially resistant clones) were seeded at 5.0 × 104 cells per well in DMEM and 5% FBS for 24 h. They were then infected with CCHFV at an MOI of 0.1, the cells recovered 24 h post infection in Trizol and then analysed by RT–qPCR. All clones that were fully or partly resistant to CCHFV infection were subjected to DNA extraction using the Gentra Puregene tissue kit (Qiagen). Paired-end 150-bp whole-exome sequencing was performed on an Illumina Novaseq 6000 instrument after precapture barcoding and exome capture with the Agilent SureSelect Mouse All Exon kit. For data analysis, raw reads were aligned to the reference genome mm9. Variants were identified and annotated using GATK 4.5.0.0 and snpEff 5.2. CCHFV resistance causing alterations were identified by allelism, only considering variants with moderate or high effect on protein and a read coverage >20.

Generation of LDLR knockout cells

A549 (ATCC, CCL-185) and Vero (CCL-81) cells were grown in complete DMEM medium (DMEM high glucose supplemented with 10% FBS (Gibco), 1x MEM-NEAA (Gibco), 1x glutamax (Gibco), 1 mM sodium pyruvate (Gibco) and 100 U ml−1 penicillin-streptomycin (Gibco)). The day before transfection, 1.05 × 105 cells were seeded per well of a 24-well plate in 0.5 complete DMEM medium. The next day, the culture medium was replaced with fresh complete DMEM medium and transfected with a liposome:DNA mixture composed of 50 µl Opti-MEM I (Gibco), 500 ng of PX459 v2.0 plasmid (Addgene 62988, Puro resistant), 1.5 µl Lipofectamine 3000 reagent and 1.0 µl P3000 reagent. Several single guide RNAs were derived from CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) using SpCas9 Cas9 knockout and the human LDLR gene as input. The final guide RNA sequence used for knockout studies was gATGAACAGGATCCACCACGA (lower letter g denotes preceding guanosine to enhance transcription from the U6 Promoter). The next day, the medium was replaced with complete DMEM supplemented with 1 µg ml−1 puromycin for transient selection. At 60 h post transfection, each well containing selected A549 or Vero cells were expanded to 1 well of a 6-well plate in complete DMEM medium. Once cells reached 80% confluency, they were dissociated with 500 µl TrypLE Express enzyme solution (Gibco) for 5 min and collected in FACS buffer (D-PBS containing 5% FBS). After one wash with FACS buffer, 10 µl of α-LDLR-PE antibody (R&D Systems, FAB2148P) per 1.0 × 106 cells were added and stained for 1 h on ice in the dark. Unmodified cells were used as controls. After 1 h of staining, cells were collected by centrifugation and washed twice in FACS buffer. Finally, cells were resuspended in 1 ml of FACS buffer and LDLR-negative cells were sorted into individual wells of a 96-well plate. LDLR-negative cells were defined as single cells displaying no PE fluorescence. Individual clones were expanded and analysed. Data were analysed during sorting with BD FACSDiva (v.9.0.1) and re-analysed for plotting of data presented in this manuscript using FlowJo (10.8.1). Unmodified A549 or Vero cells, as well as bat Tb-1 Lu cells (ATCC, CCL-88) were used as positive and negative controls, respectively. When individual cells grew to 85% confluency, they were expanded onto 24-well plates. After expansion, LDLR gene editing was verified by flow cytometry analysis using the α-LDLR-PE antibody as described above and genotyped using the forward primer F: CTAACCAGTTCCTGAAGC and reverse primer R: GCACCCAGCTTGACAGAG. For genotyping, 5.0 × 104 cells were collected and resuspended in 100 µl of nuclease-free water. DNA QuickExtract lysis solution (100 µl, Lucigen) was added and incubated for 5 min at 65 °C and 5 min at 95 °C. Of the lysis solution, 2 µl were used per 20 µl of PCR reaction containing 1x Kapa HiFi HotStart ReadyMix (Roche) and 0.5 µM of each forward and reverse primer. PCR was performed with an initial 3-min 95 °C denaturation step, followed by 35 cycles of 98 °C for 10 s, annealing at 58 °C for 20 s, extension for 1 min at 72 °C and a final extension for 2 min at 72 °C. PCR products were purified and subjected to Sanger sequencing for verification. Cells that showed Cas9 editing at the LDLR locus and negative α-LDLR staining were used as knockout for entry studies.

Cell infection

For all infections involving AN3-12, A549 and Vero cells, 5.0 × 104 cells per well were seeded in 48-well plates (Sarstedt). At 24 h post seeding, cells were infected with either VSV, VSV-CCHF_G, CCHFV (IbAr10200 or isolate) or RVFV at an MOI of 0.1 for 1 h in corresponding media containing 2% FBS. After 1 h, cells were washed once with PBS, and fresh medium containing 5% FBS was added. At 24 h (A549 and Vero) or 48 h (AN3-12) post infection, cells were washed three times with PBS and lysed with Trizol. RNA was extracted and analysed by RT–qPCR as described below.

Soluble LDLR, VLDLR and LRP8 assays

SW13 were seeded at a density of 5.0 × 104 cells per well in a 48-well plate. At 24 h post seeding, cells were counted to define the quantity of virus needed for an infection at an MOI of 0.01. The virus was then mixed in 1.5 ml tubes (Sarstedt) with the appropriate quantity of sLDLR (R&D systems), sVLDR (R&D systems) or sLRP8 (R&D systems) in L15 medium containing 0.5% FBS. The tubes were then incubated for 30 min under shaking (75 r.p.m.) at 37 °C. After 30 min, cells were rinsed once with PBS before being infected with virus only or with the mix virus/sLDLR, virus/sLRP8 or virus/VLDLR for 1 h at 37 °C. After 1 h, inocula were removed, cells washed once with PBS and L15 medium containing 5% FBS added to each well. VSV and VSV-CCHF_G entering cells and replicating very fast, cells infected with these viruses were recovered at 6 h post infection, while cells infected with CCHFV and RVFV were recovered at 24 h post infection. At the time of recovery, cells were washed three times with PBS and lysed with Trizol. RNA was extracted and analysed by RT–qPCR as described below.

Plasmid DNA constructs for BRET assay

To generate LDLR-RlucII, codon-optimized LDLR was synthesized as a gBlock (Integrated DNA Technologies) and subcloned by Gibson assembly in pcDNA3.1/Hygro(+) GFP10-RlucII db v.2 that had been linearized by PCR to exclude GFP10. To generate Nluc-LDLR, codon-optimized LDLR from LDLR-RlucII was amplified by PCR and subcloned by Gibson assembly in pcDNA3.1 Nluc-synFZD5 that had been linearized by PCR to exclude FZD5. rGFP-FYVE has been described previously33. All plasmid constructs were verified by Sanger sequencing.

Cell culture and transfection for BRET assay

HEK293 cells were propagated in plastic flasks and grown at 37 °C in 5% CO2 and 90% humidity. Cells (350,000 in 1 ml) were transfected in suspension with 1.0 µg of plasmid DNA complexed with linear PEI (MW 25,000, 3:1 PEI:DNA ratio).

BRET assaysReceptor trafficking

To monitor the trafficking of LDLR to early endosomes, HEK293 cells were transfected with LDLR-RlucII and rGFP-FYVE, and seeded in 6-well plates (7.0 × 105 cells per well). After a 48-h incubation, cells were washed once with HBSS solution, detached and resuspended in HBSS containing 0.1% BSA, distributed into white 96-well plates containing serial dilutions of LDL, CCHFV Gc, CCHFV Gn or SARS-CoV-2 RBD, and returned to the incubator for 45 min at 37 °C. Before BRET measurements, cells were incubated with coelenterazine h (10 min).

NanoBRET binding assay

To monitor the binding of fluorescent ligands to LDLR, HEK293 cells were transfected with Nluc-LDLR and seeded in white 96-well plates (3.5 × 104 cells per well). After a 48-h incubation, cells were washed once with HBSS and maintained in the same buffer. Before BRET measurements, cells were incubated with NanoBRET Nano-Glo substrate (6 min) and then stimulated with either BODIPY-FL LDL or BODIPY-FL Gc for 90 min following a baseline measurement of 3 cycles. For the competition binding assay, BODIPY-FL LDL (3.75 μg ml−1) was added together with unlabelled LDL, CCHFV Gc, CCHFV Gn or CCHFV Gc and Gn to cells expressing Nluc-LDLR for 15 min, and the area under the curve (AUC) was normalized to vehicle-treated cells.

BRET measurements

Plates were read on a Tecan Spark multimode microplate reader equipped with a double monochromator system to measure the emission of the RlucII/rGFP donor–acceptor pair in receptor trafficking experiments (430–485 nm (donor) and 505–590 nm (acceptor)) or the Nluc/BODIPY-FL donor–acceptor pair in the NanoBRET binding assay (445–470 nm (donor) and 520–575 nm (acceptor)).

Quartz crystal microbalance (kinetic experiments)

The Attana cell A250 was employed for real-time binding kinetics analysis. A recombinant LDLR protein was covalently immobilized onto the Attana LNB Carboxyl Sensor Chip (3623-3103) at the specified ligand density (20 µg) using the Amine Coupling kit (3501-3001, Attana) following manufacturer recommendations. The binding of analytes (LDL as a positive control, HFVGC, HFVGN, G38, Toscana G2) occurred at 22 °C, employing a continuous flow of D-PBS with Ca2+/Mg2+ (0.3% BSA, pH 7.4) as the running buffer at a flow rate of 10 µl min−1. Before each measurement, a reference injection (blank) of the running buffer was conducted and subtracted from the binding curves during data analysis. Sensor chips were regenerated after each measurement by injecting 10 mM glycine, pH 1.0. Consistent binding curves were observed upon repeated injections of the same analyte concentration, indicating that regeneration did not impact the surface’s binding capacity. The frequency change in sensor surface resonance (ΔF) during the binding experiments was recorded using the Attester software (Attana AB). The data were assessed and analysed using the Evaluation (Attana AB) and TraceDrawer software 1.9.1 (Ridgeview Instruments), employing 1:1 or 1:2 binding models to calculate kinetic parameters, including rate constants (ka, kd), dissociation equilibrium constant (KD) and maximum binding capacity (Bmax).

LDL competition assays

SW13 were seeded at a density of 5.0 × 104 cells per well in a 48-well plate. At 24 h post seeding, cells were counted to determine the quantity of virus needed for infection at an MOI of 0.01. CCHFV was then mixed in 1.5 ml tubes (Sarstedt) with different concentration of LDL (Thermofisher, L3486) or BSA (Saveen & Werner, A1391) in L15 medium containing 0.5% FBS. Cells were rinsed once with PBS before being infected with virus only or with the mix virus/LDL or virus/BSA for 1 h at 37 °C. After 1 h, inocula were removed, cells washed once with PBS and L15 medium containing 5% FBS added to each well. Cells were recovered at 24 h post infection. At the time of recovery, cells were washed three times with PBS and lysed with Trizol. RNA was extracted and analysed by RT–qPCR as described below.

Generation of LDLR knockout iPSC

NC8 iPSCs (male, pericyte derived) were grown on Matrigel (human embryonic stem-cells qualified, Corning) coated dishes in complete Stemflex medium (Gibco) + 1:100 antibiotic-antimycotic (Gibco) (Invivogen). Cells were passaged using 0.5 mM EDTA at a ratio of 1:6 every 3 to 4 days. The day before transfection, iPSCs were dissociated into single cells using TrypLE select (Gibco) and seeded at 5.0 × 104 cells per well of an rhLaminin521 (Gibco) coated 24-well plate in complete Stemflex medium supplemented with 1:100 RevitaCell (Gibco). The next day, the culture medium was replaced with Opti-MEM I (Gibco) + 1:00 RevitaCell and transfected with a liposome:DNA mixture composed of 50 µl Opti-MEM (Gibco), 500 ng of PX459 v2.0 plasmid with LDLR guide sequence gATGAACAGGATCCACCACGA cloned in (Addgene, 62988, Puro resistant), 1.5 µl Lipofectamine 3000 reagent and 1 µl P3000 reagent. After 4 h, the transfection mixture was removed and fresh complete Stemflex medium was added. After 48 h post transfection, complete Stemflex medium with 0.5 µg ml−1 puromycin was added for transient selection. At 60 h post transfection, selection medium was removed and cells were expanded to 1 well of a 6-well plate. Once cells reached 85% confluency, iPSCs were dissociated into single cells using TrypLE select enzyme (Gibco) and resuspended in iPSC FACS buffer (D-PBS + 1% KOSR + 1:100 RevitaCell+0.5 mM EDTA). Anti-LDLR staining was done as described for A549. LDLR-negative as well as LDLR-positive cells were sorted into rhLaminin521-coated 96-well plates containing 150 µl of complete Stemflex medium + 1:100 RevitaCell. At 4 days post sorting, the medium was replaced with complete Stemflex medium until cells reached confluency. Individual clones were expanded and analysed as described for A549 cells.

Preparation of blood vessel organoid-derived 2D monolayer for infection

Blood vessel organoids from NC8 clone 10 (LDLR+) and clone 4 (LDLR−) were produced as previously described61. To prepare the BVOs for infections, they were cut out of the matrix on day 11 of the procedure and cultured in sprouting media (StemPro-34 SFM medium (Gibco), 1X StemPro-34 nutrient supplement (Gibco), 0.5 ml glutamax (Gibco), 15% FCS, 100 ng ml−1 VEGF-A (Peprotech) and 100 ng ml−1 FGF-2 (Miltenyi Biotec)) for 5 additional days with media changes every other day. To dissociate the organoids, 25 mature blood vessel organoids per genotype were washed twice with PBS and transferred into a prefiltered and prewarmed enzymatic dissociation mix consisting of 4 mg Liberase TH (Sigma Aldrich) and 30 mg Dispase II (Life Technologies) dissolved in 10 ml PBS. The organoid containing the enzymatic mix was incubated for 25 min at 37 °C, followed by trituration 15 times with a 10 ml stripette. The 37 °C incubation and trituration were repeated for 10 min twice more. The dissociated organoids were passed through a 70 μm cell strainer into 5 ml of ice-cold DMEM/F12 medium. Following filtering, the cells were collected by centrifugation (300 × g, 5 min) and replated in PureCol (Advanced BioMatrix, 30 µg ml−1 in PBS for 1 h at r.t.) coated T-25 flasks at 30,840 cells cm−2 in sprouting media.

Ethics statement

In the current studies, we used 12 female C57BL/6J mice (000664, Charles River) and 18 female B6.129S7Ldlrtm1Her/J (Ldlr KO) mice (002207, Jackson Laboratory)62. All mice were 10 weeks old at the time of infection. The animals were housed according to Karolinska Institute ethics rules and observed daily. The Stockholm Ethical Committee for animal research approved the research. Animals were assigned to experimental groups according to their genetic backgrounds.

Antibody treatment and challenge

To make the mice susceptible to CCHFV infection, all animals received an intraperitoneal injection of 2.5 mg anti-IFN type I receptor antibody at the time of infection63. Each mouse was challenged with 400 f.f.u.s of CCHFV IbAr10200 in 100 µl via intraperitoneal injection. The mice were monitored daily for clinical signs of disease and their overall well-being. When the wild-type mice reached the predetermined humane endpoint, wild-type and one group of Ldlr −/− mice were euthanized independent of clinical signs. Blood was collected in microcontainer tubes for serum separation and serum was inactivated with Trizol for subsequent RT–qPCR analysis. In addition, liver, spleen and kidney were collected, with a portion kept in Trizol for RT–qPCR and another portion fixed in 4% paraformaldehyde for histopathological analyses. The third group of Ldlr −/− mice was monitored daily for survival and when the mice reached the predetermined human endpoint or the end of the experiment, they were euthanized.

The experimenters were not blinded to the identity of the animals. However, the pathologist who analysed livers as well as the scientist who ran the RT–qPCRs and the subsequent analysis were blinded.

Histopathology

Paraformaldehyde-fixed livers were cut into 3–4-µm-thin sections and stained for haematoxylin and eosin (H&E). The stained sections were analysed by a pathologist at BioVet, a laboratory of animal medicine (Sollentuna, Sweden).

ApoE neutralization assays

SW13 were seeded at a density of 5.0 × 104 cells per well in a 48-well plate. At 24 h post seeding, cells were counted to determine the quantity of virus needed for infection at an MOI of 0.01. The virus was then mixed in 1.5 ml tubes (Sarstedt) with 1:20 dilution of ApoE antibody (Sigma, AB947) in L15 medium containing 0.5% FBS. The tubes were then incubated for 30 min under shaking (75 r.p.m.) at 37 °C. After 30 min, cells were rinsed once with PBS before being infected with virus only or with the mix virus/ApoE antibody for 1 h at 37 °C. After 1 h, inocula were removed, cells washed once with PBS and L15 medium containing 5% FBS added to each well. VSV-CCHF_G entered cells and replicated very fast; cells infected with this virus were recovered at 6 h post infection, while cells infected with CCHFV were recovered at 24 h post infection. At the time of recovery, cells were washed three times with PBS and lysed with Trizol. RNA was extracted and analysed by RT–qPCR as described below.

RT–qPCR analysis

All RNA extractions were performed using Direct-zol RNA extraction kit (Zymo Research). Quantitative real-time PCR reactions were performed using a TaqMan Fast Virus 1-step master mix (ThermoFisher) and run on an Applied Biosystems machine. The following primers were used in this study to detect CCHFV L gene (Fwd: GCCAACTGTGACKGTKTTCTAYATGCT, Rev1: CGGAAAGCCTATAAAACCTACC TTC, Rev2: CGGAAAGCCTATAAAACCTGCCYTC, Rev3: CGGAA AGCCTAAAAAATCTGCCTTC, probe: FAM-CTGACAAGYTCAGCAAC-MGB); RVFV (Fwd: AAAATTCCTGAGAC ACATGGCAT, Rev: TCCACTTCCTTGCATCATCTGAT, Probe: FAM-CAATGTAA GGGGCCTGTGTGGACTTGTG-TAMRA); VSV-M gene (Fwd: TGATACAGTACAATTA TTTTGGGAC, Rev: GAGACTTTCTGTTACGGGATCTGG, Probe: FAM-ATGATGCA TGATCCAGC-MGB). RNase P RNA was used as an endogenous control for normalization (Fwd: AGATTTGGACCTGCGAGCG, Rev: GAGCGGCTGTCTCCACAAGT, Probe: FAM-TTCTGACCTGAAGGCTCTGCGCG-MGB).

Absolute quantification of CCHFV RNA for mice samples was performed by RT–qPCR. A 120 bp synthetic RNA corresponding to nucleotides 9,625–9,744 of CCHFV Ibar 10200L segment (GenBank MH483989.1) was produced by Integrated DNA Technologies. The standard synthetic RNA was solubilized in RNase-free water and the copy number calculated after quantification by nanodrop. The efficiency and linearity of the RT–qPCR reaction (using the primers: forward GCCAACTGTGACKGTKTTCTAYATGCT and reverse: CGGAAAGCCTAAAAAATCTGCCTTC, with probe FAM-CTGACAAGYTCAGCAAC-MGB) with the standard RNA was validated over serial 10-fold dilutions. This standard curve RT–qPCR was then performed simultaneously with RNA samples to quantify the absolute copy number of CCHFV RNA.

Statistical analyses

All analyses were done using the data from at least three independent experiments and are shown as mean ± s.d. in GraphPad Prism (v.9.4.1). One-way analysis of variance (ANOVA) (with multiple comparisons Dunnett corrections) and two-tailed Student’s t-test were used as indicated in figure legends. Data distribution was assumed to be normal, but this was not formally tested. No statistical methods were used to predetermine sample sizes but our sample sizes are similar to those reported in previous publications34,35,36,51.

Data collection was not performed blind to the conditions of the experiments, but analysis was blinded.

No animals or data points were excluded from the analyses.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.