Research objects and blood sample collection

Clinical peripheral venous blood samples were obtained from a total of 81 asthmatic patients and healthy controls at Changzhou Second People's Hospital during a period spanning from June 2020 to December 2021. The cohort consisted of two distinct groups: a healthy control group of 43 individuals, and an asthma group of 38 patients. The diagnostic criteria for asthma were in accordance with the 2020 edition of GINA [15]. The healthy control group was healthy volunteers with no history of asthma, allergic rhinitis, and other allergic and immune system disorders. The asthmatics were newly diagnosed and did not use anti-asthmatic drugs. All subjects should be excluded from comorbidities such as infection, pulmonary embolism, chronic obstructive pulmonary disease, pulmonary tuberculosis, blood system diseases and abnormal liver function. Blood routine, liver function, kidney function, blood glucose, blood lipids and electrocardiograms were performed to rule out underlying conditions. All subjects need to sign informed consent, and this study was approved by the Ethics Committee of Changzhou Second People's Hospital affiliated to Nanjing Medical University ([2020] KY213⁃01). We used EDTA anticoagulant tubes to collect peripheral vein of patients and healthy controls, and all participants' blood samples were stored in − 80 °C for the purpose of ascertaining circ_0070934, miR-199a-5p, and MGAT3 expression.

Cell culture

Human lung epithelial cell line (BEAS-2B) was obtained from Zhongqiaoxinzhou Biotech (Shanghai, China) and cultured in DMEM (Gibco, Carlsbad, CA, USA) supplied with 10% fetal bovine serum at 37 °C containing 5% CO2. Human recombinant IL-4 and IL-13 were procured from PeproTech (Suzhou, China).

Transfection

Vigorously active cells were introduced into 6-well plates. Subsequently, we employed Lipofectamine®3000 (Invitrogen, Carlsbad, CA, USA), introducing circ_0070934 overexpressed plasmids and its control group (vector), circ_0070934 small interference RNAs (si-circ_0070934) and its control group (si-NC), miR-199a-5p inhibitors and its control group (inhibitor NC) as well as miR-199a-5p mimics and its control group (miR-NC) into the cells. All the genes were purchased from Suzhou Gemma gene. After six hours, we changed to complete medium with or without IL-4 and IL-13(10 ng/mL). Subsequent experiments were performed after 48 h. The specific gene sequences were shown in Table 1.

Real-time quantitative polymerase chain reaction (qRT-PCR)

Peripheral blood was utilized for total RNA extraction employing RNA liquid overspeed whole blood total RNA extraction kit (Hutian Oriental Technology, Beijing, China). For BEAS-2B cells, Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China) was employed for extracting total RNA. The purity of RNA was measured using an ultraviolet spectrophotometer. First Strand cDNA Synthesis Kit and miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) were employed to perform reverse transcription of the extracted RNA into cDNA. Subsequently, qRT-PCR (ABI, Foster City, CA, USA) was carried out for the quantification of the RNA expression levels, utilizing AceQ qPCR SYBR Green Master Mix and miRNA Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). In peripheral blood tests, the internal parameters of circ_0070934, MGAT3, and mi-199a-5p were GAPDH, GAPDH + ACTB, and U6, respectively. In cell experiments, we regarded β-actin as a house-keeping gene for circ_0070934 and MGAT3, and regarded U6 as a house-keeping gene for miR-199a-5p. We assessed the result using the 2− ΔΔCt method. The specific primers used for qRT-PCR were presented in Table 2.

Table 2 Primers used for qRT-PCREnzyme-linked immunosorbent assay (ELISA)

ELISA kit (Beyotime, Shanghai, China) was used to detect the level of MGAT3 protein in plasma samples of asthma patients and healthy controls, and the experiment and operation were conducted in strict accordance with the kit instructions.

Western blot

BEAS-2B cells were lysed in RIPA lysis buffer supplied with protease and phosphatase inhibitor cocktail (Beyotime, Shanghai, China). Protein concentrations were determined using a BCA Assay kit from Beyotime. Protein specimens were electrophoresed on 10% sodium dodecyl sulfate polyacrylamide gel, and transferred onto polyvinylidene membrane. After blocking using phosphate buffered saline with tween-20 (PBST) blocking buffer (Beyotime, Shanghai, China) for 30 min, the blots were incubated with primary antibodies against E-cadherin, N-cadherin, Vimentin (Beyotime, Shanghai, China), MGAT3, and GAPDH (Abcam, Cambridge, UK) at 4 °C over night. Subsequently, the membranes underwent three consecutive washes using tris-buffered saline with tween-20 (TBST) as well as exposed to goat anti-rabbit IgG secondary antibody (Abcam, Cambridge, UK) at room temperature for 1.5 h. After washing, protein visualization and quantification were performed by enhanced chemiluminescence kit (Tanon, Shanghai, China). Protein evaluation was conducted through densitometric analysis through the ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Flow cytometry

Apoptosis of BEAS-2B cells were measured with Annexin V-FITC/PI Apoptosis Detection Kits (Vazyme, Nanjing, China) following manufacturer’s instructions. We collected the treated BEAS-2B from 6-well plates with trypsin, washed twice with pre-cooled phosphate saline buffer (PBS), subsequent to that, centrifugation was carried out at 1800 rpm for a duration of 5 min. Then we re-suspended them with 100 mL binding buffer, and added 5 μl PI staining solution and 5 μl Annexin V-FITC. Cells were kept in the dark for a 10 min incubation period. Finally, we added a 400 mL binding buffer prior to the analysis. Subsequently, the cells were analyzed utilizing flow cytometer (Becton Dickinson and Co, Franklin Lakes, NJ, USA). The apoptosis rates were determined by analyzing the percentage of cells that had either died or were undergoing apoptosis.

Dual-luciferase reporter assay

Circ_0070934 and MGAT3 wild-type (WT) 3'UTR sequences, along with circ_0070934 and MGAT3 mutant (MUT) 3'UTR sequences, were generated through Suzhou Gemma gene. Subsequently, 5 × 105 BEAS-2B cells seedings got performed in 24-well plates as well as transfected utilizing 500 ng WT or MUT plasmid, 50 nM miR-199a-5p mimics or negative control (NC), along with Lipofectamine®3000 (Thermo Fisher Scientific, Inc.) for 6 h at 37 °C. After 48 h of transfection, cells were harvested under 4 °C for 20 min using lysate from Dual-Luciferase®Reporter Assay System (Promega Corp.), then placed at − 80 °C refrigerator overnight. Finally, we detected firefly luminescence and renilla luminescence with the enzyme labeling instrument.

MiRNA pull-down

Biotin-labeled miR-199a-5p probes (probe sequences: CCCAGUGUUCAGACUACCUGUUC) and biotin-labeled NC negative control probes (probe sequences: UCACAACCUCCUA GAAAGAGUAGA) were synthesized by BersinBio (Guangzhou, China) and transfected into BEAS-2B cells. The concentration of the transfection probe was 100 nM for 48 h of transfection. We used the miRNA pulldown kit (Bes5108, BersinBio) to perform the miRNA pull-down assay. The miRNA-RNA complex in the cell lysate was pulled off with streptavidin magnetic beads, and the complex bounded to the magnetic beads was eluted with washing buffer. The enrichment of circ_0070934 pulled by the miR-199a-5p probe was detected by qRT-PCR.

Bioinformatics analysis

The datasets were screened from the GEO database (http://www.ncbi.nlm.nih.gov/geo) with the following selection criteria: 1. The dataset must contain genome-wide expression mRNA microarray data; 2. The dataset should include sputum samples from asthmatic patients and healthy controls. Based on the criteria the gene expression profiling dataset GSE148000 was obtained. GSE148000 contained 9 sputum samples from asthmatic patients and 7 sputum samples from healthy controls. The expression of MGAT3 in the asthma and control groups was obtained using the R package Limma.

Statistical analysis

GraphPad Prism v.8.0 (GraphPad Software Inc., San Diego, CA, USA) was used for the data analysis. To assess the differences between groups, pairwise comparisons between two groups were conducted using T-test, and for comparing multiple cohorts, one-way analysis of variance (ANOVA) was employed, as appropriate. The results were presented as mean ± standard error (SEM) based on data gathered from three independent experiments. Statistical significance was determined at a significance level of P Value < 0.05.